Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by fluorescence correlation spectroscopy and fluorescence recovery after photobleaching doc

Interestingly, Olvas–GFP could be expressed in HeLa cells, and formed granules that were similar to nuages in medaka PGCs.. The other two gene products, Nanos and Tudor of the medaka, wh

proteins by fluorescence correlation spectroscopy and

fluorescence recovery after photobleaching

Issei Nagao1,*, Yumiko Aoki2, Minoru Tanaka2and Masataka Kinjo1

1 Laboratory of Molecular Cell Dynamics, Faculty of Advanced Life Science, Hokkaido University, Sapporo, Japan

2 Laboratory of Molecular Genetics for Reproduction, National Institute for Basic Biology, Okazaki, Japan

In most animals, primordial germ cells (PGCs) develop

distinctly from other cell lineages at a very early

embryonic stage, migrate towards the prospective

gonadal area, and then differentiate into gametes in

the gonads Formation of the PGC requires germ plasm, which contains electron-dense structures called nuages that are believed to contain the determinants of germ cells [1,2] Although the nuage was reported half

Keywords

fluorescence correlation spectroscopy;

fluorescence recovery after photobleaching;

medaka; primordial germ cell; vasa

Correspondence

M Kinjo, Laboratory of Molecular Cell

Dynamics, Faculty of Advanced Life

Science, Hokkaido University, Kita 21

Nishi 11, Kita-ku, Sapporo 001-0021, Japan

Fax: +81 1 706 9006

Tel: +81 1 706 9005

E-mail: kinjo@imd.es.hokudai.ac.jp

*Present address

Biological Information Research Center,

National Institute of Advanced Industrial

Science and Technology (AIST) and Japan

Biological Informatics Consortium (JBIC),

Tokyo, Japan

Database

DNA data bank of Japan accession

numbers: olvas, AB063484; nanos3,

AB306931; tudor, AB306932

(Received 27 June 2007, revised 13

November 2007, accepted 21 November

2007)

doi:10.1111/j.1742-4658.2007.06204.x

The nuage is a unique organelle in animal germ cells that is known as an electron-dense amorphous structure in the perinuclear region Although the nuage is essential for primordial germ cell (PGC) determination and devel-opment, its roles and functions are poorly understood Herein, we report

an analysis of the diffusion properties of the olvas gene product of the medaka fish (Oryzias lapites) in PGCs prepared from embryos, using fluo-rescence correlation spectroscopy and fluofluo-rescence recovery after photo-bleaching Olvas–green fluorescent protein (GFP) localized in granules thought to be nuages, and exhibited a constraint movement with two-com-ponent diffusion constants of 0.15 and 0.01 lm2Æs)1 On the other hand, cytosolic Olvas–GFP was also observed to have a diffusion movement of 7.0 lm2Æs)1 Interestingly, Olvas–GFP could be expressed in HeLa cells, and formed granules that were similar to nuages in medaka PGCs Olvas– GFP also exhibited a constraint movement in the granules and diffused in the cytosol of HeLa cells, just as in the medaka embryo The other two gene products, Nanos and Tudor of the medaka, which are known as con-stituents of the nuage, could also be expressed in HeLa cells and formed granules that colocalized with Olvas–GFP Nanos–GFP and Tudor–GFP exhibited constraint movement in the granules and diffused in the cytosol

of HeLa cells These results suggest that these granules in the HeLa cell are not simple aggregations or rigid complexes, but dynamic structures consist-ing of several proteins that shuttle back and forth between the cytosol and the granules

Abbreviations

CMV, cytomegalovirus; EGFP, enhanced green fluorescent protein; FAF, fluorescence autocorrelation function; FCS, fluorescence correlation spectroscopy; FRAP, fluorescence recovery after photobleaching; GFP, green fluorescent protein; LSM, laser scanning microscopy; PGC, primordial germ cell; RFP, red fluorescent protein.

a century ago, its roles and functions in animal germ

lines are poorly understood Recently, it was reported

that, in Drosophila, the function of the nuage might be

related to the protection of the genome via repression

of the selfish genetic elements in the female germ line

[3] The nuage is known to be an electron-dense

struc-ture; however, little is known about its dynamic

prop-erties of morphological change or component exchange

in the cytosol in the living cell The nuage is composed

of large riboprotein complexes, and several proteins,

such as Vasa, Nanos and Tudor, have been identified

as important components In Drosophila, these

compo-nents are essential for formation of the PGC [4], and

are thought to be involved in some aspect of

transla-tion in germ cells [5–7] In the teleost fish medaka

(Oryzias latipes), Nanos and Olvas (Vasa homologs),

are expressed in PGCs in the early embryonic stages

[8–11], and are localized in granule-like structures

in the cytoplasm of the PGC (Y Aoki, I Nagao,

D Saito, Y Ebe, M Kinjo & M Tanaka,

unpub-lished results)

As a result of the recent progress in fluorescence

imaging methods and microscope technology, it has

become easy to visualize the localization of

fluorescent-ly tagged proteins, to quantitate their abundance, and

to investigate their dynamic properties such as mobility

and interactions Fluorescence correlation spectroscopy

(FCS) and fluorescence recovery after photobleaching

(FRAP) are often used to assess the dynamics and

kinetic properties of proteins in living cells [12–19]

FCS detects the fluctuations of fluorescent intensity

derived from the movement of a single fluorescent

molecule in a very tiny observation area, which is

defined by the diffraction limit of a laser beam and the

volume of which is about 0.25· 10)15L The

fluores-cence autocorrelation function (FAF) calculated from

fluctuations of probes provides the diffusional

proper-ties of proteins [13] and binding interactions [14]

FRAP is a conventional technique used to study the

kinetic properties of proteins in a cell by measuring

the fluorescence recovery rate in a bleached area [20]

Unbleached molecules enter into the bleached area

from the outside, and the fluorescence intensity is

recorded by time-lapse microscopy The recovery curve

provides qualitative and quantitative information such

as the diffusion constant and the amount of the mobile

fraction Although FCS and FRAP also provide

diffu-sion properties of fluorescent molecules, these methods

can be taken to be complementary, because FCS is

well suited to fast processes occurring in microseconds

to milliseconds in the observation area, whereas FRAP

is preferable for slower processes that take from

milli-seconds to milli-seconds [18,21,22]

Herein we report dynamic properties of proteins in the PGC determined by FCS and FRAP A fusion protein consisting of Olvas and green fluorescent pro-tein (GFP) (Olvas–GFP) expressed in the PGC forms granules that exhibit an amorphous shape and time-dependent morphological changes The movements of Olvas–GFP in the nuage and the cytosol were quite different, suggesting that this protein interacted with a cellular matrix such as the cytoskeleton or assembled itself to form larger complexes When the protein was expressed in HeLa cells, Olvas–GFP formed distinct granules that colocalized with Nanos or Tudor In the granules, these three proteins exhibit very characteristic movements, suggesting that the formation of the gran-ules is not merely an artificial phenomenon, but that it could be used for investigation of the features of PGCs

Results

Time-lapse laser scanning microscopy (LSM) image analysis of Olvas reveals the dynamic nature of the nuage

Previous studies showed that the 3¢-UTR of genes for nuage components was essential for germ cell-specific expression of the components [10,11] Figure 1 shows

a schematic diagram of the Olvas–GFP fusion con-structs used in this study RNA transcribed from these constructs in vitro was injected into medaka eggs in the one-cell stage to visualize the localization and to mea-sure the mobility of the components in the PGCs The medaka embryo was peeled off the chorion, and the segment containing the part of PGCs was excised for observation by microscopy and FCS measurements (Fig 2A) We performed time-lapse 3D LSM analysis

of Olvas–GFP in migrating PGCs Olvas–GFP was observed at 0, 1, 2, 3, 4 and 9 min in the migrating PGCs at stage 24 (Fig 2B) It was localized as differently sized granules in the cytoplasm, and the granules occupied a large volume in the cell, as seen in the zebrafish [23] Time-lapse LSM observation revealed the morphological changes of nuage structure, such as one granule combining with another and one dividing into two or more parts (arrowhead in Fig 2B)

Olvas–GFP shuttles between the nuage and cytosol

Next, we analyzed the diffusion of Olvas–GFP in the PGCs prepared from the embryo, using FCS and FRAP (Fig 3) Movement of Olvas–GFP was

measured outside of the nuage in the cytoplasm of the

migrating PGC FCS analysis revealed that Olvas–

GFP diffused with a diffusion constant of 7.0 lm2Æs)1

(Fig 3A) During the measurement of the PGC, the

GFP/RFP 3'UTR

nanos 3'UTR

GFP-3'UTR

GFP/RFP- olvas

GFP/RFP GFP/RFP GFP/RFP

GFP/RFP- nanos

GFP/RFP- tudor

Fig 1 Schematic diagram of the constructs microinjected into the medaka eggs and transfected into HeLa cells The olvas, nanos and tudor coding sequences were joined to the C-terminal region of the GFP or RFP coding sequence in an in-frame manner These fusion genes were derived from the T7 promoter and CMV promoter in the case of in vitro transcription and in the case of HeLa cells, respectively.

Glass-bottom plate

Medaka embryo

Lateral plate mesoderm

B

A

Fig 2 Time-lapse LSM analysis of Olvas–GFP reveals the dynamic

nature of the nuage Schematic diagram of the preparation of PGCs

of medaka specimen (A) Olvas–GFP was expressed in the medaka

PGC at stage 24 and localized in the nuage 3D imaging of Olvas–

GFP was performed at the indicated times (B) The nuage was

seen around the nucleus and came together and apart in this time

scale Arrowheads show the assembly and dissociation points.

0 0.2 0.4 0.6 0.8 1 1.2

0 0.4 0.8 1.2 1.6

2

A

B

Time (s)

Time (µs)

Fig 3 FCS and FRAP analyses of Olvas–GFP in the PGC FCS was used to measure the movement of Olvas–GFP into the cytosol out of the nuage region of the PGC Representative correlation curves are shown (A) The measurement point is indicated by the cross-hair (+)

in the LSM image of Olvas–GFP transiently expressed in PGCs (inset) The correlation curve of Olvas–GFP (squares) shifted to a slower part as compared to GFP (diamonds) only In the cytosol, Olvas–GFP diffused at D = 7.0 lm2Æs)1 FRAP analysis was per-formed in the nuage region (B) The curve is the mean of three inde-pendent measurements The bleached position is indicated by the white circle (inset) FRAP curve analysis shows that Olvas–GFP moves slowly at D = 0.15 lm 2 Æs)1and D = 0.01 lm 2 Æs)1.

specimen was alive and moved slowly; the FCS

mea-surement was done in 3 s, which is a short time as

compared to usual FCS measurement Such a short

period of FCS measurement caused the correlation

curve to be noisy This diffusion constant was smaller

than that calculated, as the molecules moved

com-pletely free from cellular interactions, such as

mono-mer and⁄ or oligomer tandem GFP, thought to be a

noninteractive protein in the HeLa cell [24], suggesting

the existence of some interactive cellular partner

FRAP analysis of the nuage revealed the slow recovery

of Olvas–GFP (Fig 3B) When the whole part of the

single compartment of nuage was bleached, slow

recovery of the fluorescence was observed, indicating

that Olvas–GFP was provided from the cytosol The

obtained curve indicated that Olvas–GFP has two

dif-fusion constant components, 0.15 and 0.01 lm2Æs)1

These results indicate that Olvas–GFP shuttles between

the nuage and the cytosol

GFP and red fluorescent protein (RFP) fusion

proteins of Olvas, Nanos and Tudor form

granules in transfected HeLa cells

To investigate the mobility of Olvas–GFP in detail,

we performed in vitro analysis using HeLa cells A

fusion gene was constructed with the cytomegalovirus

(CMV) promoter and simian virus 40 poly(A) signal

Surprisingly, Olvas–GFP formed granules in the

cytoplasm (Fig 4) To verify that these granules were

not merely the simple aggregates often seen in

trans-fected cultured cells, a nanos–RFP or tudor–GFP

fusion gene was cotransfected with the olvas–GFP or

olvas–RFP fusion gene, and diffusion analysis by

FCS and FRAP was performed As shown in

Fig 4A, Olvas–GFP and Nanos–RFP colocalized on

the granules in the cytoplasm, and similarly, Olvas–

RFP shared the granules with Tudor–GFP (Fig 4B)

Next, we carried out FCS and FRAP analyses to

determine the mobility of Olvas–GFP, Nanos–GFP

and Tudor–GFP in HeLa cells (Fig 5) FCS

measurement revealed that these three proteins

dif-fused with diffusion constants of 11.7, 12.9 and

5.4 lm2Æs)1, respectively, in the part of the cytoplasm

outside of the granules FRAP analysis in the

gran-ules provided typical recovery curves of these fusion

proteins: a diffusion constant with two components

of 0.9 and 0.03 lm2Æs)1 in Olvas–GFP, a diffusion

constant of 1.7 lm2Æs)1 in Nanos–GFP, and a

diffu-sion constant of 0.16 lm2Æs)1 in Tudor–GFP These

results suggest that these granules are not simply

artificial aggregations, but might have some features

of the nuage in the PGC

Deletion analysis of Olvas–GFP indicates that the DEAD-box motif might play a role in dynamic properties

The vasa gene is known to encode a putative RNA helicase and to have a DEAD-box motif [25] To examine the involvement of the DEAD-box motif in protein mobility, we constructed Olvas–GFP deletion mutants (Fig 6A), and transfected these constructs

Olvas-GFP / Nanos-RFP

Merge

A

Tudor-GFP / Olvas-RFP

Merge

B

Fig 4 Olvas, Nanos and Tudor fusion proteins expressed in the HeLa cell form granules olvas–GFP and nanos–RFP (A), and olvas– RFP and tudor–GFP (B), were cotransfected into HeLa cells LSM images of the HeLa cells are presented These proteins formed granules in the cytoplasm Olvas–GFP and Nanos–RFP, and Olvas– RFP and Tudor–GFP, are colocalized in the granules.

into HeLa cells Eight conserved motifs of the olvas

gene [18] are depicted in black boxes in Fig 6B The

del1, del2 and del3 mutants lack the two N-terminal

motifs, six N-terminal motifs, and two C-terminal

motifs, respectively All three deletion series of proteins

were uniformly present in the cytoplasm in large

popu-lations of transfected cells (Fig 6B, upper panels)

However, in a small number of transfected cells,

fluo-rescent granules were found in the cytoplasm (Fig 6B,

lower panels) FCS analysis revealed that all deletion mutants had diffusion constants ranging from 10.5 to 11.3 lm2Æs)1 in the cytosol (Fig 7A) In contrast, FRAP analysis revealed that Olvas–GFP deletion pro-teins were almost all immobilized in the granules (Fig 7B), clearly indicating that these granules could

be discriminated from the granules observed in Fig 4B These granules containing Olvas deletion mutants might have been artificial aggregations, which are sometimes seen with overexpression in cultured cells Once freely moving Olvas deletion molecules formed such an aggregation, they would be fixed in it, and not have a functioning shuttle mechanism, like native Olvas This result indicates that the domains including a complete set of DEAD-box motifs are important in localizing the granules and in dynamic protein mobility

Discussion

Herein we report the dynamic nature of Olvas–GFP expressed in medaka embryos and HeLa cells Time-lapse LSM image analysis of the Olvas–GFP distribu-tion reveals that the shape of the nuage changes in a matter of minutes in migrating PGCs Moreover, diffu-sion analysis reveals that Olvas–GFP remains in the nuage for seconds, and that Olvas–GFP in the cytosol diffuses rather freely Although the nuage has been analyzed as an important structure for the formation and maintenance of germ cells [1,2], this is the first report that rapid protein exchange occurs in the cyto-sol and nuage in the germ cell This may imply that the constituents of the nuage are changed and replaced during the developmental stages

We observed that Olvas–GFP expressed in HeLa cells also formed granules that were similar to nuages

in medaka PGCs Furthermore, the colocalization of Nanos–RFP or Tudor–GFP with the Olvas fusion gene strongly suggests that molecular interaction with each protein occurred in the granules

Olvas–GFP shows characteristic movement in both the nuages of PGCs of medaka embryos and the gran-ules in HeLa cells FRAP revealed that it moved with two diffusion components in both PGCs and HeLa cells: 0.15 and 0.01 lm2Æs)1 in PGCs, and 0.9 and 0.03 lm2Æs)1 in HeLa cells The observation of two components here indicates that more than two compo-nents or architectures are involved in the formation

of the granules Such multicomponents have been observed in the P-body and stress granule [26] In the cytosol of both PGCs and HeLa cells, diffusing protein was observed The other two components of the nuage, Nanos and Tudor, exhibit diffusion constants of 1.7

0

0.2

0.4

0.6

0.8

1

1.2

0

0.2

0.4

0.6

0.8

1

1.2

1.4

A

B

Time (s)

Time (µs)

Fig 5 FCS and FRAP analyses of Olvas–GFP, Nanos–GFP and

Tudor–GFP in HeLa cells Diffusion of Olvas–GFP, Nanos–GFP and

Tudor–GFP was measured by FCS in the cytosol outside the region

of the granule Representative correlation curves are shown (A).

Measurement points are indicated by the cross-hair (+) in the LSM

image of Olvas–GFP transiently expressed in a HeLa cell (inset).

These curves for Olvas–GFP (diamonds), Nanos–GFP (squares) and

Tudor–GFP (triangles) exhibit diffusion constants D = 11.7 lm 2

Æs)1,

D = 12.9 lm 2 Æs)1 and D = 5.4 lm 2 Æs)1, respectively FRAP

analy-ses of Olvas–GFP, Nanos–GFP and Tudor–GFP were performed for

the granule (B) Each curve is the mean of 10 independent

mea-surements The bleached position is indicated by the white circle

(inset) These recovery curves show diffusion constants

D = 0.9 lm2Æs)1and D = 0.03 lm2Æs)1 for Olvas–GFP (diamonds),

D = 1.7 lm 2 Æs)1 for Nanos–GFP (squares), and D = 0.16 lm 2 Æs)1

for Tudor–GFP (triangles).

and 0.16 lm2Æs)1, respectively, in granules of HeLa

cells when observed using FRAP In the cytosol of

HeLa cells, diffusing Nanos and Tudor proteins were

also observed by FCS Their diffusion constants were

12.9 and 5.4 lm2Æs)1, respectively FCS and FRAP can

be considered as complementary techniques, as FRAP

can be employed to examine slow processes of

replace-ment of molecules in granules from other parts of the

same granules or from the cytosol We performed a

bleaching experiment in a whole part of a single

com-partment of the granule, followed by fluorescence

recovery The fluorescence recovery suggests that the

nonbleached GFP fusion proteins in the granule are

replaced from the cytosol These results show that

Olvas–GFP, Nanos–GFP and Tudor–GFP shuttle

between the granules and the cytosol, and that

exchange within the granule might also occur; however,

we cannot discriminate between the two possible modes

of recovery, replacement from the cytosol, and

replace-ment through the cytosol from other granules

Deletion analyses of Olvas–GFP show that all

dele-tion mutants are defective in formation of the

functional granules, indicating that their formation is

dependent on the complete set of the DEAD-box motifs in olvas These results indicate that the granules are not merely artificial aggregates, thought to be the result of protein misfolding, but might reflect the nat-ure of the nuage in the PGC

Recently, there have been some reports that germline-specified microRNAs are essential in germ cell develop-ment [27] Vasa is also thought to interact with Piwi and Aubergine, which are members of the AGO protein family [28,29], suggesting that the nuage is implicated in the Piwi-interacting RNA pathway It has been shown that the nuage contains RNAs and proteins that may have important roles in the development of PGCs [1–3]

It is interesting that rapid exchange of nuage compo-nents occurred, because such exchange suggests that the nuage is not only a static storage site, but also a dynamic RNA- and protein-processing particle In this sense, our finding that cultured HeLa cells expressed Olvas, Nanos and Tudor provides a very attractive system with which to investigate the features of PGCs Although these tests were carried out in HeLa cells only, they could potentially be applied to other types of cultured cells

GFP

Olvas-GFP

GFP

GFP

del1

del2

385 278

617 1

del3

GFP

489 1

B

A

Fig 6 Expression of Olvas deletion series

in HeLa cells Schematic diagrams of Olvas deletion series constructs are shown (A) The numbers of amino acid sequences are presented above each drawing These cod-ing sequences were derived from the CMV promoter Eight conserved regions are indi-cated in black boxes (B) LSM image of Olvas deletion series in HeLa cells The deletion series constructs were transfected into HeLa cells, and the LSM images observed are presented In some cells, there are granules that are thought to be aggregations.

Experimental procedures

Plasmid construction

cDNA cloning by RT-PCR amplification of olvas, nanos

and tudor coding sequences from Oryzias latipes was

described elsewhere [8,10] (Aoki et al., unpublished results)

The coding sequences of olvas, nanos and tudor were

modified by PCR with BglII and EcoRI, using primers 5¢-GGAGATCTAAAATGGACGACTGGGAGGAAGA-3¢

GGAGAAAAC-3¢, 5¢-CGAGATCTAGCATGTCAGACG TGGAGTCTGGA-3¢ and 5¢-GCGAATTCGCAACCAAA GACAACCTGGTTTTAATGTTTTGA-3¢, and 5¢-CGAG ATCTGAAATGAACGAGCTGCGTATGCCGAA-3¢ and 5¢-GCGAATTCAACACAAGAGTTGTTTTATATTGAA CCCA-3¢, respectively The PCR product was digested and ligated into the multiple cloning site of pEGFP-Cl (Clontech, Palo Alto, CA, USA) or mRFP [30] This plas-mid encoded fluorescent protein and Olvas, Nanos or Tudor fusion proteins [enhanced GFP (EGFP)–Olvas,

Tudor, and mRFP–Tudor chimera], and was transcribed from the CMV promoter

In vitro RNA synthesis and microinjection

The olvas–GFP described above was employed as a template for PCR, using primers 5¢-GCGCTAGCTAAT ACGACTCACTATAGGGAGATCTAAAATGGACGAC

ACTTTTAATTATCAGGAGAAAAC-3¢ This PCR frag-ment has a T7 promoter for RNA synthesis Capped RNA was synthesized by T7 RNA polymerase, using an mMes-sage mMachine T7 Kit (Ambion, Inc., Austin, TX, USA)

No poly(A) tail was added Finally, 100 ngÆlL)1RNA was injected into a one-cell embryo

Cell culture and transfection with plasmid DNA

HeLa cells were grown in a 5% CO2humidified atmosphere

at 37C in DMEM supplemented with 10% fetal bovine serum, 2· 105

UÆL)1 penicillin G, and 200 mgÆL)1 strepto-mycin sulfate Cells were propagated every 1 or 2 days For transient expression, cells were plated at a confluence of 10–20% on LAB-TEK chambered coverslips with eight wells (Nalge Nunc International, Naperville, IL, USA) for

12 h before transfection DMEM (20 lL) and FuGENE 6 (1.2 lL; Roche Molecular Biochemicals, Mannheim, Ger-many) were mixed Five minutes after mixing, 0.4 lg of the Olvas–GFP, Nanos–GFP and Tudor–GFP or Olvas–RFP, Nanos–RFP and Tudor–RFP fusion protein-encoding plas-mid DNAs was added to the prediluted FuGENE 6 solu-tion The DNA solution was left for 15 min, and added to one well 12 h before FCS measurement

Microscopy

Live-cell fluorescence microscopy was performed using an LSM510 inverted confocal laser scanning microscope (LSM; Carl Zeiss, Jena, Germany) EGFP was excited at the 488 nm laser line of a CW Ar+ laser, and mRFP was excited at the

0

0.5

1

1.5

2

1 10 100 1000 10 000 100 000

0

0.2

0.4

0.6

0.8

1

1.2

B

A

Time ( μs)

Time (s)

Fig 7 FCS and FRAP analyses of Olvas deletion series in HeLa

cells Deletion series diffusion was measured by FCS in the cytosol

outside the region of the granule Representative correlation curves

are shown (A) FCS analysis of Olvas deletion series revealed that

all these proteins diffused in the cytosol at D = 11.3 lm 2 Æs)1(del1;

diamonds), D = 10.5 lm2Æs)1(del2; squares), and D = 10.9 lm2Æs)1

(del3; triangles), respectively FRAP analyses of Olvas deletion

ser-ies were performed in the granule structure (B) The analyses of

the FRAP recovery curves indicated that most of these proteins

were immobile.

543 nm laser line of a CW He–Ne laser through a water

immersion objective (C-Apochromat, 40·, 1.2 NA; Carl

Ze-iss) Emission signals were detected at > 505 nm for EGFP

and > 560 nm for mRFP by single or sequential scanning

FCS setup

FCS measurements were carried out with a ConfoCor2

(Carl Zeiss), which consisted of a CW Ar+ laser, a water

immersion objective (C-Apochromat, 40·, 1.2 NA; Carl

Zeiss), and an avalanche photodiode (SPCM-200-PQ;

EG&G, Quebec, Canada) The confocal pinhole diameter

was adjusted to 70 lm Samples were excited with about

10 kWÆcm)2of laser power at 488 nm, and the fluorescence

signal was detected through a dichroic mirror (> 510 nm)

and a bandpass filter (515–560 nm)

FCS measurement and analysis

To remove the chorion, the embryo was peeled with tweezers

and put on LAB-TEK chambered coverslips in 1·

Yamam-oto’s Ringer solution containing 3.5 mm 1-heptanol (3.5 m

stock solution; Wako, Osaka, Japan) Cultured cells were

washed with phenol red-free Opti-MEM I reduced-serum

medium (Invitrogen, Carlsbad, NM, USA) twice to remove

phenol red dye; then the medium was replaced by

Opti-MEM I Immediately thereafter, FCS measurements were

carried out The obtained FAF was fitted by a

one-compo-nent, two-component or three-component model (i = 2 or 3

in the following equation) as follows:

G sð Þ ¼hI tð ÞI t þ sð Þi

I

h i2 ¼ 1 þ

1 N X

i

Fi 1þs si

1þ s

s2si

where Fiand siare the fraction and diffusion time of

compo-nent i, respectively, N is the number of fluorescent molecules

in the detection volume element defined by radius w0 and

length 2z0, and s is the structure parameter representing the

ratio, s = z0⁄ w0 FAFs of rhodamine 6G (Rh6G) solution

were measured for 30 s three times at 10 s intervals; then the

diffusion time (sRh6G) and s were obtained by one-component

fitting of the measured FAFs Diffusion constants of samples

(Dsample) were calculated from the ratio with the diffusion

constant of Rh6G, DRh6G(2.8· 10)6cm2Æs)1), and diffusion

times sRh6G and ssample were obtained as the following

equation:

Dsample

DRh6G

¼ sRh6G

ssample

FRAP analysis

FRAP measurements were performed on the same setup of

the laser scanning microscope as used for FCS analysis

The detection gain was adjusted to the fluorescence of the

GFP fusion proteins almost at the saturation level of the

detector, and the pinhole was opened widely enough to acquire fluorescence from the cell Ten single scans were acquired, followed by four bleach pulses without scanning Single section images were collected at 0.2 s intervals FRAP curves were created using the following equation:

Ft¼ ðT0  BtÞ=ðTt  B0Þ

in which Ft is the normalized fluorescence at time point t,

T0 and Tt represent the fluorescence in the whole cell at time points 0 and t, respectively, and B0 and Bt represent the fluorescence in the bleached region at time points 0 and

t Diffusion constants were determined by classic FRAP analysis [20]

Acknowledgements

The authors thank Professor Hiroshi Kimura (Kyoto University, Japan) for technical advice on the FRAP experiment This research was supported by the 21st Century COE Program for ‘Advanced Life Science on the Base of Bioscience and Nanotechnology’ in Hok-kaido University This research was partly supported

by Grands-in-Aid for Scientific Research (A) 18207010 from JSPS, and Grants-In-Aid for Scientific Research (Kakenhi) ‘Nuclear Dynamics (17050001)’ by the Ministry of Education, Culture, Sports, Science and Technology of Japan (to M Kinjo)

References

1 Wylie C (2000) Germ cells Curr Opin Genet Dev 10, 410–413

2 Ikenishi K (1998) Germ plasm in Caenorhabditis elegans, Drosophilaand Xenopus Dev Growth Differ 40, 1–10

3 Lim AK & Kai T (2007) Unique germ-line organelle, nuage, functions to repress selfish genetic elements in Drosophila melanogaster Proc Natl Acad Sci USA 104, 6714–6719

4 Rongo C & Lehmann R (1996) Regulated synthesis, transport and assembly of the Drosophila germ plasm Trends Genet 12, 102–109

5 Raz E (2000) The function and regulation of vasa-like genes in germ-cell development Genome Biol 1, doi:1017.1-1017.6

6 Parisi M & Lin H (2000) Translational repression: a duet of Nanos and Pumilio Curr Biol 10, 81–83

7 Thomson T & Lasko P (2005) Tudor and its domains: germ cell formation from a Tudor perspective Cell Res

15, 281–291

8 Shinomiya A, Tanaka M, Kobayashi T, Nagahama Y

& Hamaguchi S (2000) The vasa-like gene, olvas, identifies the migration path of primordial germ cells during embryonic body formation stage in the

medaka, Oryzias latipes Dev Growth Differ 42, 317–

326

9 Tanaka M, Kinoshita M, Kobayashi D & Nagahama Y

(2001) Establishment of medaka (Oryzias latipes)

trans-genic lines with the expression of green fluorescent

pro-tein fluorescence exclusively in germ cells: a useful

model to monitor germ cells in a live vertebrate Proc

Natl Acad Sci USA 98, 2544–2549

10 Kurokawa H, Aoki Y, Nakamura S, Ebe Y,

Kobayashi D & Tanaka M (2006) Time-lapse analysis

reveals different modes of primordial germ cell

migra-tion in the medaka Oryzias latipes Dev Growth Differ

48, 209–221

11 Herpin A, Rohr S, Riedel D, Kluever N, Raz E &

Schartl M (2007) Specification of primordial germ cells

in medaka (Oryzias latipes) BMC Dev Biol 7, 3,

doi:10.1186/1471-213X-7-3

12 Schwille P, Haupts U, Maiti S & Webb WW (1999)

Molecular dynamics in living cells observed by

fluores-cence correlation spectroscopy with one- and

two-photon excitation Biophys J 77, 2251–2265

13 Terada S, Kinjo M & Hirokawa N (2000) Oligomeric

tubulin in large transporting complex is transported via

kinesin in squid giant axons Cell 103, 141–155

14 Saito K, Ito E, Takakuwa Y, Tamura M & Kinjo M

(2003) In situ observation of mobility and anchoring

of PKCbI in plasma membrane FEBS Lett 541,

126–131

15 Phair RD & Misteli T (2000) High mobility of proteins

in the mammalian cell nucleus Nature 404, 604–609

16 Shav-Tal Y, Darzacq X, Shenoy SM, Fusco D, Janick

SM, Spector DL & Singer RH (2004) Dynamics of

single mRNPs in nuclei of living cells Science 304,

1797–1800

17 Kitamura A, Kubota H, Pack CG, Matsumoto G,

Hirayama S, Takahashi Y, Kimura H, Kinjo M,

Mori-moto RI & Nagata K (2006) Cytosolic chaperonin

prevents polyglutamine toxicity with altering the

aggre-gation state Nat Cell Biol 8, 1163–1170

18 Lippincott-Schwartz J, Snapp E & Kenworthy A (2001)

Studying protein dynamics in living cells Nat Rev Mol

Cell Biol 2, 444–456

19 Phair RD & Misteli T (2001) Kinetic modelling

approaches to in vivo imaging Nat Rev Mol Cell Biol 2,

898–907

20 Axelrod D, Koppel DE, Schlessinger J, Elson E & Webb WW (1976) Mobility measurement by analysis of fluorescence photobleaching recovery kinetics Biophys J

16, 1055–1069

21 Politz JC, Browne ES, Wolf DE & Pederson T (1998) Intranuclear diffusion and hybridization state of oligo-nucleotides measured by fluorescence correlation spec-troscopy in living cells Proc Natl Acad Sci USA 95, 6043–6048

22 Wachsmuth M, Weidemann T, Muller G, Hoffmann-Rohrer UW, Knoch TA, Waldeck W & Langowski J (2003) Analyzing intracellular binding and diffusion with continuous fluorescence photobleaching Biophys J

84, 3353–3363

23 Wolke Uta, Weidinger G, Koprunner M & Raz E (2002) Multiple levels of posttranscriptional control lead

to germ line-specific gene expression in the zebrafish Curr Biol 12, 289–294

24 Pack C, Saito K, Tamura M & Kinjo M (2006) Micro-environment: an effect of energy depletion in the nucleus analyzed by mobility of multiple oligomeric EGFPs Biophys J 91, 3921–3936

25 Sengoku T, Nureki O, Nakamura A, Kobayashi S & Yokoyama S (2006) Structural basis for RNA unwind-ing by the DEAD-box protein Drosophila Vasa Cell

125, 287–300

26 Anderson P & Kedersha N (2006) RNA granules J Cell Biol 172, 803–808

27 Girard A, Sachidanandam R, Hannon GJ & Carmell

MA (2006) A germline-specific class of small RNAs binds mammalian Piwi proteins Nature 442, 199– 202

28 Megosh HB, Cox DN, Campbell C & Lin H (2006) The role of PIWI and the miRNA machinery in Drosophila germline determination Curr Biol 16, 1884–1894

29 Findley SD, Tamanaha M, Clegg NJ & Ruohola-Baker

H (2003) Maelstrom, a Drosophila spindle-class gene, encodes a protein that colocalizes with Vasa and RDE1⁄ AGO1 homolog, Aubergine, in nuage Develop-ment 130, 859–871

30 Campbell RE, Tour O, Palmer AE, Steinbach PA, Baird GS, Zacharias DA & Tsien RY (2002) A mono-meric red fluorescent protein Proc Natl Acad Sci USA

99, 7877–7882