Tài liệu Báo cáo khoa học: Regulation of dCTP deaminase from Escherichia coli by nonallosteric dTTP binding to an inactive form of the enzyme ppt

Previous structural studies showed that the complexes of inactive mutant protein, E138A, with dUTP or dCTP bound, and wild-type enzyme with dUTP bound were all highly similar and charact

nonallosteric dTTP binding to an inactive form of the

enzyme

Eva Johansson1,2, Majbritt Thymark1, Julie H Bynck1, Mathias Fanø3, Sine Larsen1,2

and Martin Willemoe¨s3

1 Centre for Crystallographic Studies, Department of Chemistry, University of Copenhagen, Denmark

2 European Synchrotron Radiation Facility, Grenoble, France

3 Department of Molecular Biology, University of Copenhagen, Denmark

Synthesis of dTMP by thymidylate synthase proceeds

by the reductive methylation of dUMP, which is

obtained via one of two parallel pathways One

path-way, considered to be a minor supplier of dTTP [1–3],

involves the reduction of UDP (UTP) by the action of ribonucleotide reductase Subsequently, dUDP is phos-phorylated to dUTP and cleaved to dUMP The main supply of dUMP, however, involves the deamination

Keywords

deoxynucleotide metabolism; dUTP; enzyme

regulation; hysteresis; deamination

Correspondence

E Johansson, Diabetes Protein Engineering,

Novo Nordisk A ⁄ S, Novo Nordisk Park,

DK-2760 Ma˚løv, Denmark

Fax: +45 4444 4256

Tel: +45 4442 1189

E-mail: evjh@novonordisk.com

or

M Willemoe¨s, Department of Molecular

Biology, University of Copenhagen, Ole

Maaløes vej 5, DK-2200 Copenhagen N,

Denmark

Fax: +45 3532 2128

Tel: +45 3532 2030

E-mail: willemoes@mermaid.molbio.ku.dk

Database

The atomic coordinates and structure

fac-tors have been deposited in the Protein

Data Bank with the PDB ID codes 2j4q

(E138:dTTP) and 2j4 h (H121A:dCTP) and

can be accessed at http://www.rcsb.org

(Received 12 April 2007, revised 12 June

2007, accepted 18 June 2007)

doi:10.1111/j.1742-4658.2007.05945.x

The trimeric dCTP deaminase produces dUTP that is hydrolysed to dUMP

by the structurally closely related dUTPase This pathway provides 70–80% of the total dUMP as a precursor for dTTP Accordingly, dCTP deaminase is regulated by dTTP, which increases the substrate concentra-tion for half-maximal activity and the cooperativity of dCTP saturaconcentra-tion Likewise, increasing concentrations of dCTP increase the cooperativity of dTTP inhibition Previous structural studies showed that the complexes of inactive mutant protein, E138A, with dUTP or dCTP bound, and wild-type enzyme with dUTP bound were all highly similar and characterized by hav-ing an ordered C-terminal When comparhav-ing with a new structure in which dTTP is bound to the active site of E138A, the region between Val120 and His125 was found to be in a new conformation This and the previous con-formation were mutually exclusive within the trimer Also, the dCTP com-plex of the inactive H121A was found to have residues 120–125 in this new conformation, indicating that it renders the enzyme inactive The C-ter-minal fold was found to be disordered for both new complexes We suggest that the cooperative kinetics are imposed by a dTTP-dependent lag of product formation observed in presteady-state kinetics This lag may be derived from a slow equilibration between an inactive and an active confor-mation of dCTP deaminase represented by the dTTP complex and the dUTP⁄ dCTP complex, respectively The dCTP deaminase then resembles a simple concerted system subjected to effector binding, but without the use

of an allosteric site

Abbreviations

E138A, mutant dCTP deaminase with a Glu138 to Ala substitution; H121A, mutant dCTP deaminase with a His121 to Ala substitution; V122G, mutant dCTP deaminase with a Val122 to Gly substitution.

of a deoxycytidine nucleotide [1–3] In eukaryotes and

most of the well-studied Gram-positive bacteria (e.g

Bacillus subtilis) a dCMP deaminase supplies dUMP

directly by deamination of dCMP [4–6] dCMP

deami-nase is structurally related to cytosine- and cytidine

deaminases [7], which are all metallo enzymes [8–10]

In other prokaryotes, dUMP is derived mainly from

dCTP In Escherichia coli [11] and Salmonella enterica

serovar Typhimurium [3,12] a dCTP deaminase

produ-ces dUTP, which is subsequently cleaved by dUTPase

to dUMP In the archaeon Methanocaldococcus

janna-schii, a bifunctional dCTP deaminase:dUTPase has

been identified This enzyme produces dUMP directly

from dCTP by catalysing both the deamination and

the triphosphate cleavage reaction within the same

act-ive site [13,14]

Monofunctional and bifunctional dCTP deaminases

are both structurally closely related to trimeric

dUTPases They belong to the same superfamily and

form trimers of identical subunits [15–18] In

accord-ance with the ‘branch point’ position in

deoxynucleo-tide metabolism and in particular in dTTP synthesis,

both the dCMP- and the dCTP deaminases are

inhibited by dTTP [5,12] For dCMP deaminase,

dTTP regulation occurs by binding of the inhibitor

to an allosteric site in competition with the activator

dCTP [7] For dCTP deaminase, the mechanism of

dTTP regulation is not understood Only dCTP

deaminases can bind dTTP, whereas the closely

related dUTPase has very low affinity for this

nuc-leotide in a concentration range of several orders of

magnitude above physiological levels [19,20] This

selectivity against dTTP (and dCTP) in the dUTPase

active site is obviously to avoid the breakdown of

important deoxyribonucleotides while facilitating the

extremely important removal of the toxic

intermedi-ate, dUTP [21–23]

Kinetic analysis of dCTP deaminase from S

ent-erica serovar Typhimurium showed competitive

inhibition of dCTP binding by dTTP However, the

presence of dTTP in the assay incubation also

increased the apparent cooperativity of dCTP

bind-ing, which indicates that the mechanism of dTTP

inhibition is not caused only by a trivial competition

between substrate and inhibitor for binding to the

same site [12] We have previously determined the

structures of wild-type dCTP deaminase in complex

with dUTP and the inactive E138A mutant protein

in complex with dUTP and dCTP In all cases, we

observed an ordered C-terminal that was closed over

the active site, but in a different conformation to

that observed for dUTPase For both the mono- and

bifunctional dCTP deaminases, as we show here, and

the dUTPase [24], the C-terminal fold is important for the formation of a catalytically competent com-plex by closing the active site, but not for binding

of the substrates In this study, we present results from structural and mechanistic studies on dTTP inhibition of E coli dCTP deaminase Coordinated closure of the active site and rearrangement of the main chain and side chains in the active site appear

as key players in a slow transformation from an inactive to an active enzyme dTTP inhibition may then be achieved by stabilizing the inactive form of presumably both the mono- and bifunctional dCTP deaminases

Results

Structure analysis The E138A E coli dCTP deaminase variant in com-plex with dTTP crystallized in space group P6322 The structure was determined using the molecular replace-ment technique with wild-type E coli dCTP deaminase

in complex with dUTP as a search model that was pre-viously crystallized in space group P21 [18] (Protein Data Bank code 1XS1) The two different crystal forms were obtained under similar conditions using PEG400 as precipitant The structure forms a homo-trimer that exists in two copies in the E138A:dTTP structure The two copies are designated A and B, originating from the A and B chains in the structure dTTP binds at the site of the protein shown previously

to bind the nucleotides dUTP and dCTP in wild-type and the E138A variant [18] The nucleotide-binding site is positioned between two of the subunits giving rise to three active sites per trimer In the previously determined structures of the enzyme, the C-terminal amino acid residues from one of these subunits are folded to form a lid over the active site which interacts with the bound nucleoside triphosphate In the struc-ture in which dTTP is bound, the C-terminal amino acid residues are disordered and not visible in the elec-tron-density map (Fig 1) Furthermore, the c-phos-phate of dTTP is not visible in the electron-density map and a magnesium ion is only seen bound to the phosphates of dTTP in one of the two subunits Large movement of a helix 2 (residues 55–65) [18] is also observed If the C-terminal residues had been folded over the active site, as shown in previous structures of

E coli dCTP deaminase, these residues would have coincided with a helix 2 in this new position (Fig 1B)

A loop containing active-site residues in the interior of the enzyme (residues 120–125) is also totally different compared with previously determined E coli dCTP

deaminase structures (Figs 1B, 2 and 3) Interestingly,

the crystal structure of the other inactive mutant

enzyme H121A in complex with dCTP was very

similar to the structure of E138A in complex with

dTTP In the H121A complex we also observed a

dis-ordered C-terminus and rearrangement of active-site

residues 120–125 that was almost identical to the

E138A complex (Fig 2D,E)) Wild-type E coli dCTP

deaminase in complex with dTTP crystallized in the

same form and under similar conditions as for the

E138A:dTTP and H121A:dCTP complexes However,

resolution of the diffraction data for the wild-type

enzyme in complex with dTTP was poor (3.5 A˚) As a

result, details of the active site of the wild-type:dTTP

complex were not as informative as for the E138A

variant, although the active-site structure of the

wild-type complex was reminiscent of this

Enzyme kinetics and equilibrium binding Figure 4A shows the results from a steady-state kinetic analysis of dTTP inhibition of dCTP deaminase by varying dCTP in the absence or presence of 100 lm dTTP As found previously for the enzyme from

S entericaserovar Typhimurium [12], the cooperativity

of dCTP saturation increased in the presence of dTTP The Hill coefficient, n, increased from ~ 1.5 to 3, the apparent half-saturation constant, S0.5, increased 2.5-fold and kcat remained the same as in the absence of dTTP When dTTP was varied in the presence of a constant saturating or unsaturating concentration of dCTP, inhibition was cooperative and the dTTP con-centration for 50% inhibition, I0.5, and the correspond-ing Hill coefficient increased with the increase in dCTP concentration (Fig 4B)

A

B

Fig 1 Comparison of dCTP deaminase structures (A) Superposition of the E138A trimer in complex with dCTP (grey) and dTTP (yellow, cyan and magenta) (B) Stereo-view of a superposition of one of the sub-units of the E138A variant of E coli dCTP deaminase in complex with dTTP (yellow; chain B), dUTP (cyan; Protein Data Bank entry 1XS4, chain A), or dCTP (magenta; Protein Data Bank entry 1XS6, chain A) The nucleotides are shown in ball and stick rep-resentations and the magnesium ions as spheres The N-terminus (N) and the extent

to which the C-termini were resolved in the dTTP complex (C1) and the dCTP ⁄ dUTP complexes (C2) are indicated The solid arrow points to the region of a helix 2 and

b strand 5 that moved towards the active site in the absence of an ordered C-terminal fold The dotted arrow points to the region

in the active site constituted by residues 120–125 that deviated in position between the dCTP ⁄ dUTP complexes and the dTTP complex The figure was created using

PYMOL (DeLano Scientific, San Carlos, CA).

Analysis of the presteady-state kinetic behaviour of

dCTP deaminase using rapid quench-flow experiments

showed a lag in the progress of product formation

(Fig 4C) This lag, which indicates slow activation of the enzyme upon substrate binding prior to the forma-tion of a catalytic complex, increased in the presence

D

E B

Fig 2 Electron-density maps and close up stereoview of residues 120–124, 138 and nucleotides in the active site of E coli dCTP deami-nase and mutant enzymes Electron-density maps for the (A) E138A dTTP complex and (B) H121A dCTP complex where the blue mesh rep-resents the 2F o ) F c map contoured at 1 r and the green mesh represents the F o ) F c electron density map contoured at 3 r (C) Superposition of the structures of E138A in complex with dTTP (yellow; chain B), and the wild-type enzyme in complex with dUTP (cyan; Protein Data Bank entry 1XS1, chain A) Wat5 is the proposed catalytic water molecule (D) Superposition of the structures of H121A in complex with dCTP (magenta; chain B), and the wild-type enzyme in complex with dUTP (cyan; Protein Data Bank entry 1XS1, chain A) Wat5 is the proposed catalytic water molecule (E) Superposition of the structures of E138A in complex with dTTP (yellow; chain B) and H121A in complex with dCTP (magenta; chain B).The figures were created using PYMOL (DeLano Scientific).

of dTTP Significant estimates of the initial velocity,

Vini, could not be obtained when fitting Eqn (4) to the

data A fixed value of Vini to < 0.1 times the

steady-state velocity, Vss, greatly increased the errors of the

calculated constants in Eqn (4) Therefore, Vini was

fixed at 0 when performing the calculations The late

data points obtained in the absence of dTTP showed a

deviation from linearity caused by beginning substrate

depletion (Fig 4C) and were omitted from the

calcula-tions Unfortunately, we were not able to perform

presteady-state experiments at subsaturating substrate

concentrations to fully characterize the kinetics of the

slow transition from inactive to active enzyme [25]

Attempts to do so were hampered by the experimental

requirement for high enzyme concentrations both in

terms of estimating the true free-ligand concentration

in the experiments and by rapid substrate depletion

resulting in an underestimation of Vss

dTTP binding to dCTP deaminase was also

investigated by equilibrium binding This revealed a

hyperbolic binding curve (Fig 4D) with a stochiometry

of 1 : 1 of dTTP bound per subunit of dCTP

deaminase

Mutational analysis of amino acid residues involved in dTTP regulation of dCTP deaminase The design of the mutant enzymes H121A and V122G was inspired by the results from analysis of crystal structures as discussed later Both mutant enzymes were produced in similar amounts as wild-type enzyme and could be purified by the same procedure as for wild-type enzyme However, none of the mutant enzymes displayed detectable activity

Discussion

As mentioned, we have previously published the struc-tures of wild-type dCTP deaminase in complex with dUTP and the inactive mutant protein E138A in com-plex with dUTP and dCTP [18] In E138A the sugges-ted catalytic base, Glu138, is replaced by alanyl Comparison between structures of the complexes of wild-type and mutant dCTP deaminase revealed that the E138A complexes provide a good model for the interaction between dCTP deaminase and bound ligand The interactions with bound nucleotide are

Fig 3 Close-up stereoview of the centre of the homotrimer of E coli dCTP deaminase with focus on residues Val122 and Thr123 (A) Superposition of E138A with dTTP bound and wild-type enzyme with dUTP bound suggested to represent the inactive and active conformers of dCTP deaminase, respectively E138A in complex with dTTP is shown in yellow and the wild-type enzyme

in complex with dUTP in cyan (Protein Data Bank entry 1XS1, chain A) (B) Superposition

of the same region as above of the inactive H121A in complex with dCTP shown in magenta compared with the wild-type enzyme in complex with dUTP in cyan (Pro-tein Data Bank entry 1XS1, chain A) The superposition demonstrates the likely struc-tural incompatibility between the two con-formers due to a clash of the side chains of Val122 and Thr123 as indicate by the arrows The figure was created using PYMOL

(DeLano Scientific).

similar with only small changes in the arrangement of

water molecules around the 4 position of the

pyrimid-ine ring [18] In this study, we compared the structures

of dCTP deaminase, represented by E138A, in complex

with all three nucleotides that bind to the enzyme

A superposition of the trimer of E138A with the

nucleotides dCTP or dTTP bound is shown in Fig 1A

Whereas the previously determined structures of

E138A in complex with dCTP or dUTP overall are

virtually identical [18], the new dTTP complex revealed

a disordered C-terminus This difference between the two types of complex is more easily reconciled in the comparison of a single subunit of E138A in complex with dUTP, dCTP or dTTP (Fig 1B) In the dTTP complex, the entrance to the active site had partly col-lapsed caused by a movement of the lip formed by

a helix 2 and b strand 5 [18] Apparently, movement of the active site lip prevented binding of the C-terminal residues over the active site, or the absence of the C-terminal residues caused the movement of the lip (Fig 1B) In addition, the Cachain between amino acid residues 120 and 125 (Fig 2C) was rearranged in the dTTP complex to accommodate the 5-methyl group of the thymine moiety As a result, the Ala124 carbonyl was moved from the 4-oxo⁄ 4-amino group of the bound nucleotide and the side chain of His121 was flipped to a position where in the wild-type enzyme it would intersect Glu138 and C4 of the pyrimidine ring (Fig 2C) In addition, the nucleophilic water molecule [18], wat5, appeared in the dTTP complex to be expelled by the His121 side chain from its position in the dCTP(dUTP) complex between Glu138 and the Ala124 carbonyl (Fig 2C) Also, in the dTTP com-plex the side chains of Thr123 and Val122 had moved

to new positions The significance of this last observa-tion is that due to the proximity of residues 120–125 from each subunit in the centre of the trimer, the side chains of Val122 of one subunit and Thr123 of the neighbouring subunit are likely to clash unless each subunit is in the same conformation (Fig 3A,B) As a consequence, Thr123 and Val122 may mediate a concerted switch between the dCTP(dUTP)-binding conformer and the dTTP-binding conformer of dCTP deaminase We were not able to identify structural changes in the main chain of the subunit, or in the interaction of subunits within the trimer that linked the conformation of residues 120–125 to the position

of the active site lip and closure of the C-terminal end over the active site However, it is reasonable to expect these two events to be associated but the structural change that mediates the communication between the two regions appears to be very subtle

Based on the observations described above, mutant alleles encoding the enzymes H121A and V122G were constructed to analyse the roles of His121 and Val122

in catalysis and regulation of dCTP deaminase Removal of the imidazole ring in H121A was anticipa-ted to relieve or reduce inhibition by dTTP by prevent-ing expulsion of the water molecule, wat5, as described above (Fig 2C) Replacing the Val122 side chain in V122G aimed to relieve the suggested concerted struc-tural transition of the trimer and perhaps reduce the inhibition by dTTP As mentioned in the results, the

Fig 4 Initial rate and presteady-state kinetics of dTTP inhibition

and dTTP binding to dCTP deaminase Assays were performed as

described in Experimental procedures (A) The concentration of

dCTP varied as indicated in the absence (closed circles) or

pres-ence (open circles) of 100 l M dTTP The kinetic constants

calcula-ted using Eqn (1) were (closed circles) k cat ¼ 1.24 ± 0.09 s)1,

S0.5¼ 66 ± 9 l M , n ¼ 1.5 ± 0.3 and (open circles) kcat¼

1.20 ± 0.05 s)1, S 0.5 ¼ 168 ± 8 l M , n ¼ 3.3 ± 0.4 (B) The dTTP

concentration varied as indicated in the presence of (open circles)

100 l M dCTP and (closed circles) 500 l M dCTP Kinetic constants

calculated using eqn (2) were (open circles) I0.5¼ 53 ± 6 l M and

n ¼ 1.31 ± 0.15 and (closed circles) I 0.5 ¼ 826 ± 89 l M and n ¼

1.7 ± 0.3 (C) Presteady-state kinetics of dCTP deaminase

Experi-ments were performed as described in Experimental procedures

with enzyme in the absence (closed circles) or presence (open

cir-cles) of dTTP The kinetic parameters were calculated using Eqns

(4–6) The calculated constants were (closed circles) ratess¼

0.79 ± 0.06 s)1with s ¼ 0.49 ± 0.13 s (k ¼ 2.0 s)1) and (open

cir-cles) rate ss ¼ 0.16 ± 0.02 s)1 with s ¼ 2.3 ± 0.5 s (k ¼ 0.43 s)1).

For comparison the straight lines represent the calculated

steady-state rate in the absence of a lag (D) dTTP binding to dCTP

deaminase Binding experiments were performed as described in

Experimental procedures The nucleotide concentration varied as

indicated The binding constants calculated using Eqn (3) were

N max ¼ 1.01 ± 0.02 and K d ¼ 35 ± 3 l M

mutant proteins were both inactive and unfortunately

no suitable crystals for the structural analysis of

V122G could be obtained However, the conformation

of the main chain in the region of residues 120–125 in

the H121A:dCTP complex was found to strongly

devi-ate from that of wild-type enzyme in complex with

dUTP and almost superimpose with the same region in

the structure of the E138A:dTTP complex (Fig 2E,D)

In addition, the H121A:dCTP complex, like the

E138A:dTTP complex, had a disordered C-terminal

fold, which again indicates a connection between the

position of residues 120–125 and folding of the

C-ter-minal

We anticipate that the E138A:dTTP complex

resem-bles the binding of dTTP to wild-type enzyme, as

also expected from the crystallographic analysis of

the wild-type:dTTP described Therefore, the lack of

activity of H121A and the structural similarity between

the H121A:dCTP and the E138A:dTTP complexes

(Fig 2E) suggest a mechanism for dTTP inhibition

that not only acts by physical blocking of the active

site, but also through a concerted change to an

inac-tive conformation of the acinac-tive sites in the trimer The

observation that the complexes of H121A:dCTP and

E138A:dTTP are also very similar in terms of the

posi-tion of Val122 and Thr123 (Fig 3) supports such a

mechanism Interestingly, there are no indications as

to why the inhibited⁄ inactive conformation should

exclude the binding of dCTP (or dUTP) This

import-ant observation is discussed below

Obviously, there is competition between dCTP and

dTTP for binding to the active site, as revealed by the

crystal structures of the various complexes Also, results

from kinetic experiments point to a competitive

mech-anism for dTTP inhibition; an increase in S0.5for dCTP

in the presence of dTTP (Fig 4A) and an increase in

I0.5 for dTTP with increasing dCTP concentrations

(Fig 4B) From the equilibrium binding experiment

presented in Fig 4D it can be seen that dTTP binds to

only one type of site with no cooperativity

The lag observed in presteady-state kinetics shown

in Fig 4C is a clear indication that the mechanism of

regulation of dCTP deaminase is not a simple rapid

equilibrium mechanism The observed increase in

cooperativity of dTTP inhibition at increasing dCTP

concentrations (Fig 4B), but complete absence of

cooperativity in equilibrium binding of dTTP

(Fig 4D), indicates that the cooperativity effect of

dTTP inhibition is a kinetic phenomenon Given the

right circumstances, a lag in the progress of product

formation is known to produce what is termed kinetic

cooperativity and several enzyme systems have been

shown to possess such properties [25–28] The k for

activation of dCTP deaminase is of the same order of magnitude as the kcat(Fig 4A,), a condition that qual-ifies for causing kinetic cooperativity, and very import-ant, the lag is increased in the presence of dTTP The increase in cooperativity of dCTP saturation in the presence of dTTP may therefore be explained by a mechanism in which dTTP stabilizes an inactive form that dominates the population of free enzyme, recall that Vini (or rateini) is likely to be less than Vss (or ratess) by an order of magnitude Upon binding of dCTP the proceeding structural changes in the active site and proper folding of the C-terminus may contrib-ute to the lag observed in presteady-state kinetics (Fig 4C)

Finally, it should be pointed out that each of the two species-specific, but dominant, pathways for dUMP synthesis described above are very similar from

a regulatory point of view dCMP deaminase is activa-ted by dCTP and inhibiactiva-ted by dTTP and both nucleo-tides act on the enzyme by binding to an allosteric site

to alter the cooperativity of dCMP binding [5,29,30] The activity of dCTP deaminase depends on the con-centration of dCTP and is inhibited by dTTP Our results suggest that regulation of dCTP deaminase is not by a conventional allosteric mechanism, but appar-ently utilizes the property of the enzyme to exist in two conformations and that dTTP stabilizes the inac-tive form by binding to the acinac-tive site In this way, dCTP deaminase can use one nucleotide-binding site

to gain a pseudo-allosteric mechanism of regulation that generates the apparently attractive feature of an increase in both S0.5and the sigmoidity of the satura-tion curve for dCTP in response to the binding of dTTP to the enzyme

Experimental procedures

Materials All buffers, nucleotides and salts were obtained from Sig-ma-Aldrich (Darmstadt, Germany) Radioactive nucleotides were obtained as ammonium salts from Amersham Bio-sciences (Hillerød, Denmark) TLC was performed with poly(ethylene-imine)-coated cellulose plates from Merck (Darmstadt, Germany)

Molecular biology and protein methods Construction of mutant alleles of the dcd gene encoding the dCTP deaminases H121A and V122G was achieved by performing the QuikChange method (Stratagene, La Jolla, CA) using the oligo-deoxynucleotides, where underlined letters indicate the site of mutagenesis: H121A5–3,

GGGCTGATGGTGGCCGTCACCGCGCAC; H121A3–5,

GTGCGCGGTGACGGCCACCATCAGCCC; V122G5–3,

GATGGTGCACGGCACCGCGCACC; V122G3-5, GGT

GCGCGGTGCCGTGCACCATC The plasmid pETDCD

described previously [18] was used as a template for

muta-genesis The pETDCD plasmid contains the reading frame

of the E coli dcd gene under control of the late T7

promo-ter in the vector pET11a (Novagen, Darmstadt, Germany)

All mutations were verified by sequencing of the entire dcd

reading frame on an ABI PRISM 310 sequencer according

to the supplier’s manual Wild-type and mutant protein was

produced and purified as described previously [18]

Enzyme kinetics and equilibrium binding

experiments

Initial velocities were obtained at 37C using TLC and

subsequent liquid scintillation counting to first separate and

then quantify [5-3H] dUTP produced from [5-3H] dCTP, as

described in detail previously [14] Data were recorded over

5 min at two enzyme concentrations (50–100 nm) and the

assay incubations contained in addition to varying concen-trations of the nucleotides dCTP and dTTP, as shown under results, 50 mm Hepes, pH 6.8, 2 mm MgCl2 and

2 mm dithiothreitol Presteady-state experiments were per-formed at 37C using a KinTek RQF-3 rapid quench flow instrument by mixing dCTP deaminase (20 lm) in the pres-ence or abspres-ence of 100 lm dTTP and 150 lm [5-3H] dCTP

in 50 mm Hepes, pH 6.8, 2 mm MgCl2 and 2 mm dithio-threitol at time 0 and quenching the reaction with 3 m formic acid at the time points given under results Subse-quently, the samples representing each time point were sub-jected to TLC and analysed for the distribution of radioactivity in spots of [5-3H] dCTP and [5-3H] dUTP as above for steady-state kinetic samples

In equilibrium binding experiments, the incubations con-tained dCTP deaminase (50–100 lm), 50 mm Hepes,

pH 6.8, 2 mm MgCl2and between 0 and 320 lm [methyl-3H] dTTP Free nucleotide was separated from bound using Amicon Ultrafree-MC 30.000 NMWL centrifugal filter devices, as described previously [31,32] Samples represent-ing free and total radioactive nucleotide were washed by TLC in 1 m acetic acid, cut out and quantified by liquid scintillation as above for samples from kinetic experiments Data from presteady-state and steady-state kinetic and equilibrium binding experiments were analysed using the computer program ultrafit from biosoft (v 3.0) The equations used were: the Hill equation, Eqn (1), for sigmoid saturation curves

rate¼ kcat½Sn=ðSn

0:5þ ½SnÞ ð1Þ where rate is the initial turnover of the enzyme with a maximum of kcat, S0.5is the concentration of substrate S at half-maximal saturation of the enzyme and n is the Hill coefficient Equation (2) was used for sigmoid inhibition

rateinh¼ rate In

0:5=ðIn 0:5þ ½InÞ ð2Þ where rateinhis the initial rate corresponding to the presence

of a given concentration of inhibitor I and I0.5is the concen-tration of inhibitor for half-maximal inhibition Equation (3) was used for hyperbolic binding of ligands to the enzyme

N¼ Nmax½L=ðKdþ ½LÞ ð3Þ where N is the degree of binding with the dissociation con-stant Kdof ligand L to the enzyme with a maximal number

of binding sites Nmax Equations (4–6) were used to analyse the data recorded for presteady-state kinetics

P¼ Vsst ðVss ViniÞð1  et=sÞs ð4Þ ratess¼ Vss=½Enzyme ð5Þ rateini¼ Vini=½Enzyme ð6Þ where P is the product and Viniand Vssare the initial and steady-state velocities (rateiniand ratessare the corresponding

Table 1 Diffraction data and refinement statistics Values within

parentheses are data for the highest resolution shell R merge ¼

S|I– <I> | ⁄ SI, where I is observed intensity and <I> is

aver-age intensity obtained from multiple observations of symmetry

related reflections R factor ¼ S work ||F obs | ) k|F calc || ⁄ S work F obs R free ¼

S test ||Fobs| ) k|F calc || ⁄ S test Fobs, where Fobs and Fcalc are observed

and calculated structure factors, respectively, k is the scale factor,

and the sums are over all reflections in the working set and test

set, respectively rmsd, root mean square deviation.

Diffraction data statistics

Resolution (A ˚ ) 50–2.6 (2.74–2.6) 50–2.7 (2.85–2.7)

Refinement statistics

No reflections (working

set)

Resolution (A ˚ ) 30–2.6 (2.67–2.60) 30–2.7 (2.77–2.70)

Rfactor(%) 24.7 (30.1) 22.8 (31.7)

Bond length rms

from ideal (A ˚ )

Bond angle rmsd

from ideal (deg)

rates) prior to and after the transition of the enzyme to a

more active form, respectively, t is the time and s is the

lag-time The rate constant, k, for the activation of the enzyme is

obtained as 1⁄ s

Crystallization

Crystals were grown in hanging drops as described

previ-ously [18] using the vapour-diffusion technique with

hang-ing drops Protein solutions contained 3.7 or 5.1 mgÆmL)1

protein for H121A and E138A mutant enzymes,

respect-ively, as well as 5 mm dCTP (H121A) or dTTP (E138A)

and 20 mm magnesium chloride in 50 mm Hepes, pH 6.8

This solution was mixed in equal amounts with the mother

liquor (2 lL +2 lL) that consisted of 34% poly(ethylene

glycol 400), 0.2 m magnesium chloride and 0.1 m Hepes,

pH 7.5 and the drop was equilibrated over 1 mL of mother

liquor at room temperature Long (> 1 mm) needle-formed

crystals appeared after one week

Diffraction data collection

Diffraction data were collected on cryo-cooled crystals

(100 K) at beam-line I911-2 at MAX-LAB (Lund, Sweden)

using a MarMosaic 225 CCD detector from MAR

Research Auto-indexing and integration of the data were

performed with mosflm [33] and scala [34] was used for

scaling All the crystals belonged to space group P6322

with cell dimensions a¼ b ¼ 61.6, c ¼ 244.8 A˚ (E138A +

dTTP) and diffracted X-rays well However, the long c-axis

prevented collection of high-resolution data

Structure determination and refinement

The structure of the E138A mutant enzyme cocrystallized

with dTTP was determined with the molecular

replace-ment technique using the program amore [35] The chain

A of wild-type dCTP deaminase in complex with dUTP

(Protein Data Bank entry 1XS1) stripped from ligands

and water molecules, was used as a search model The

correct solution contained two molecules in the

asymmet-ric unit that each forms a separate trimeasymmet-ric structure as a

result of the crystal symmetry The initial difference

elec-tron-density maps revealed density for the nucleotide

which was built using the program o [36] However, the

final model only showed electron density for a magnesium

ion in one of the molecules of the asymmetric unit (chain

B) and there was no electron density visible for the

c-phosphate of dTTP Therefore, the structure was

modelled with dTDP in the active sites There was no

electron density for the C-terminal 20 amino acid residues

that were omitted from the model Initially, the stretch of

amino acid residues from 121 to 125 was also unclear and

was excluded from the model Cycles of refinement using

noncrystallographic symmetry restraints with refmac5 [37] and model building with o [36] were performed and now enabled model building of the 121–125 stretch and a new position of a helix 2, containing residues 55–65 in one of the molecules in the asymmetric unit (chain B) Further-more, the model contains residues 1–174 in chain A, resi-dues 1–171 in chain B and three water molecules in each chain The structure of the H121A mutant enzyme cocrys-tallized with dCTP was determined using difference Fou-rier techniques with the model of the E138A protein crystallized in the same space group (P6322) Refinement and model building proceeded as for E138A cocrystallized with dTTP The final model includes residues 1–171 in chain A, residues 1–174 in chain B and two magnesium ions, both coordinated to the modelled dCDP, because there was no electron density for the c-phosphate of dCTP Data and refinement statistics are shown in Table 1 The quality of the models was checked with pro-check [38] and whatif [39] The Ramachandran plot has 91.2% of the residues in the most favoured regions There are no residues in the disallowed regions and 0.7% of the residues are in the generously allowed regions (correspond-ing to His121 in both chains) for the E138A mutant struc-ture cocrystallized with dTTP For the H121A strucstruc-ture, 92.3% of the residues are in the most favoured regions and Ala121 and Val122 form a cis-peptide that puts them

in the generously allowed and disallowed regions, respect-ively, of the Ramachandran plot

Acknowledgements

We are grateful for the beam time provided at MAX-LAB (Lund, Sweden) This study was supported by the Danish Natural Science Council through a grant and a contribution to DANSYNC We acknowledge the support by the European Community – Research Infrastructure Action under the FP6 programme

‘Structuring the European Research Area’

References

1 Bianchi V, Pontis E & Reichard P (1987) Regulation of pyrimidine deoxyribonucleotide metabolism by substrate cycles in dCMP deaminase-deficient V79 hamster cells Mol Cell Biol 7, 4218–4224

2 Mollgaard H & Neuhard J (1978) Deoxycytidylate deaminase from Bacillus subtilis Purification, charac-terization, and physiological function J Biol Chem

253, 3536–3542

3 Neuhard J & Thomassen E (1971) Deoxycytidine triphosphate deaminase: identification and function in Salmonella typhimurium J Bacteriol 105, 657–665

4 Nucci R, Raia CA, Vaccaro C, Rossi M & Whitehead

EP (1991) Allosteric modifier and substrate binding of

donkey deoxycytidylate aminohydrolase (EC 3.5.4.12).

Arch Biochem Biophys 289, 19–25

5 Ellims PH, Kao AY & Chabner BA (1983) Kinetic

behaviour and allosteric regulation of human

deoxycyti-dylate deaminase derived from leukemic cells Mol Cell

Biochem 57, 185–190

6 McIntosh EM & Haynes RH (1984) Isolation of a

Saccharomyces cerevisiaemutant strain deficient in

deoxycytidylate deaminase activity and partial

charac-terization of the enzyme J Bacteriol 158, 644–649

7 Almog R, Maley F, Maley GF, Maccoll R & Van Roey

P (2004) Three-dimensional structure of the R115E

mutant of T4-bacteriophage 2¢-deoxycytidylate

deami-nase Biochemistry 43, 13715–13723

8 Weiner KX, Weiner RS, Maley F & Maley GF (1993)

Primary structure of human deoxycytidylate deaminase

and overexpression of its functional protein in

Escheri-chia coli J Biol Chem 268, 12983–12989

9 Porter DJ & Austin EA (1993) Cytosine deaminase The

roles of divalent metal ions in catalysis J Biol Chem

268, 24005–24011

10 Ko TP, Lin JJ, Hu CY, Hsu YH, Wang AH & Liaw

SH (2003) Crystal structure of yeast cytosine deaminase

Insights into enzyme mechanism and evolution J Biol

Chem 278, 19111–19117

11 O’Donovan GA, Edlin G, Fuchs JA, Neuhard J &

Thomassen E (1971) Deoxycytidine triphosphate

deami-nase: characterization of an Escherichia coli mutant

defi-cient in the enzyme J Bacteriol 105, 666–672

12 Beck CF, Eisenhardt AR & Neuhard J (1975)

De-oxycytidine triphosphate deaminase of Salmonella

typhimurium Purification and characterization J Biol

Chem 250, 609–616

13 Li H, Xu H, Graham DE & White RH (2003) The

Met-hanococcus jannaschiidCTP deaminase is a bifunctional

deaminase and diphosphatase J Biol Chem 278,

11100–11106

14 Bjornberg O, Neuhard J & Nyman PO (2003) A

bifunctional dCTP deaminase–dUTP

nucleotidohydro-lase from the hyperthermophilic archaeon

Methanocaldococcus jannaschii J Biol Chem 278,

20667–20672

15 Cedergren-Zeppezauer ES, Larsson G, Nyman PO,

Dauter Z & Wilson KS (1992) Crystal structure of a

dUTPase Nature 355, 740–743

16 Chan S, Segelke B, Lekin T, Krupka H, Cho US, Kim

MY, So M, Kim CY, Naranjo CM, Rogers YC et al

(2004) Crystal structure of the Mycobacterium

tuberculo-sisdUTPase: insights into the catalytic mechanism

J Mol Biol 341, 503–517

17 Johansson E, Bjornberg O, Nyman PO & Larsen S

(2003) Structure of the bifunctional dCTP deaminase–

dUTPase from Methanocaldococcus jannaschii and its

relation to other homotrimeric dUTPases J Biol Chem

278, 27916–27922

18 Johansson E, Fano M, Bynck JH, Neuhard J, Larsen S, Sigurskjold BW, Christensen U & Willemoes M (2005) Structures of dCTP deaminase from Escherichia coli with bound substrate and product: reaction mechanism and determinants of mono- and bifunctionality for a family of enzymes J Biol Chem 280, 3051–3059

19 Climie S, Lutz T, Radul J, Sumner-Smith M, Vanden-berg E & McIntosh E (1994) Expression of trimeric human dUTP pyrophosphatase in Escherichia coli and purification of the enzyme Protein Expr Purif 5, 252– 258

20 Nord J, Larsson G, Kvassman JO, Rosengren AM & Nyman PO (1997) dUTPase from the retrovirus equine infectious anemia virus: specificity, turnover and inhibi-tion FEBS Lett 414, 271–274

21 Guillet M, Van Der Kemp PA & Boiteux S (2006) dUTPase activity is critical to maintain genetic stability

in Saccharomyces cerevisiae Nucleic Acids Res 34, 2056–2066

22 Galperin MY, Moroz OV, Wilson KS & Murzin AG (2006) House cleaning, a part of good housekeeping Mol Microbiol 59, 5–19

23 Kouzminova EA & Kuzminov A (2004) Chromosomal fragmentation in dUTPase-deficient mutants of Escheri-chia coliand its recombinational repair Mol Microbiol

51, 1279–1295

24 Nord J, Kiefer M, Adolph HW, Zeppezauer MM & Nyman PO (2000) Transient kinetics of ligand binding and role of the C-terminus in the dUTPase from equine infectious anemia virus FEBS Lett 472, 312–316

25 Kurganov BI, Dorozhko AK, Kagan ZS & Yakovlev

VA (1976) The theoretical analysis of kinetic behaviour

of ‘hysteretic’ allosteric enzymes I The kinetic manifes-tations of slow conformational change of an oligomeric enzyme in the Monod, Wyman and Changeux model

J Theor Biol 60, 247–269

26 Ainslie GR Jr, Shill JP & Neet KE (1972) Transients and cooperativity A slow transition model for relating transients and cooperative kinetics of enzymes J Biol Chem 247, 7088–7096

27 Neet KE & Ainslie GR Jr (1980) Hysteretic enzymes Methods Enzymol 64, 192–226

28 Frieden C (1979) Slow transitions and hysteretic behav-ior in enzymes Annu Rev Biochem 48, 471–489

29 Maley F & Maley GF (1982) Studies on identifying the allosteric binding sites of deoxycytidylate deaminase

J Biol Chem 257, 11876–11878

30 Maley GF & Maley F (1982) Allosteric transitions asso-ciated with the binding of substrate and effector ligands

to T2 phage induced deoxycytidylate deaminase Biochemistry 21, 3780–3785

31 Ormo M & Sjoberg BM (1990) An ultrafiltration assay for nucleotide binding to ribonucleotide reductase Anal Biochem 189, 138–141