Tài liệu Báo cáo khoa học: Hsp105b upregulates hsp70 gene expression through signal transducer and activator of transcription-3 pdf

Using a series of deletion mutants of Hsp105b, it was revealed that the region between amino acids 642 and 662 of Hsp105b is necessary for the activation of the hsp70 promoter by Hsp105b

signal transducer and activator of transcription-3

Nobuyuki Yamagishi, Hajime Fujii, Youhei Saito and Takumi Hatayama

Department of Biochemistry & Molecular Biology, Division of Biological Sciences, Kyoto Pharmaceutical University, Japan

Introduction

Heat shock proteins are a set of highly conserved

pro-teins produced in response to physiological and

envi-ronmental stresses that serve to protect cells from

stress-induced damage by preventing protein

denatur-ation and⁄ or repairing such damage [1] Mammalian

heat shock proteins are classified into several families

on the basis of their apparent molecular weight and

function, such as Hsp105⁄ 110, Hsp90, Hsp70, Hsp60,

Hsp40, and Hsp27 The Hsp70 family is the major and

best-characterized group of heat shock proteins Several different species of Hsp70 family proteins are present in different compartments of eukaryotic cells, and play important roles as molecular chaperones that prevent the irreversible aggregation of denatured proteins Hsp70 family proteins also assist in the folding, assembly and translocation across the mem-brane of cellular proteins [2,3] Hsp70 family proteins are commonly composed of three functional domains:

Keywords

heat shock protein; Hsp70; Hsp105b;

nuclear localization; STAT3

Correspondence

T Hatayama, Department of Biochemistry &

Molecular Biology, Division of Biological

Sciences, Kyoto Pharmaceutical University,

5 Nakauchi-cho, Misasagi, Yamashina-ku,

Kyoto 607-8414, Japan

Fax: +81 75 595 4758

Tel: +81 75 595 4653

E-mail: hatayama@mb.kyoto-phu.ac.jp

(Received 14 May 2009, revised 3 August

2009, accepted 7 August 2009)

doi:10.1111/j.1742-4658.2009.07311.x

Hsp105a and Hsp105b are mammalian members of the Hsp105⁄ 110 family,

a divergent subgroup of the Hsp70 family Hsp105a is expressed constitu-tively and induced by various forms of stress, whereas Hsp105b is an alter-natively spliced form of Hsp105a that is expressed specifically during mild heat shock In a report, it was shown that Hsp105a and Hsp105b localize

to the cytoplasm and of nucleus of cells, respectively, and that Hsp105b, but not Hsp105a, induces the expression of Hsp70 in mammalian cells Here, we examined the mechanism by which Hsp105b induces the expres-sion of Hsp70 Using a series of deletion mutants of Hsp105b, it was revealed that the region between amino acids 642 and 662 of Hsp105b is necessary for the activation of the hsp70 promoter by Hsp105b Further-more, it was shown that signal transducer and activator of transcription (STAT)-3 bound to the sequence of the hsp70 promoter between)206 and )187 bp, and that mutations of this sequence abrogated the activation of the hsp70 promoter by Hsp105b In addition, overexpression of Hsp105b stimulated the phosphorylation of STAT3 at Tyr705 and its translocation

to the nucleus Downregulation of STAT3 expression resulted in reduction

of the activation of the hsp70 promoter by Hsp105b Furthermore, downre-gulation of Hsp105b reduced the expression of Hsp70 in heat-shocked cells

On the basis of these findings, it is suggested that Hsp105b induces Hsp70 expression markedly through the STAT3 pathway in heat-shocked cells This may represent the mechanism that connects the heat shock protein and STAT families for cell defense against deleterious stress

Abbreviations

DOX, doxycycline; HSE, heat shock element; HSF, heat shock factor; INFa, interferon a; JAK, Janus kinase; NLS, nuclear localization signal; siRNA, small interfering RNA; STAT, signal transducer and activator of transcription.

the highly conserved N-terminal ATPase domain binds

ADP⁄ ATP, and can hydrolyze ATP; the central

b-sheet domain directly binds peptide substrates; and

the C-terminal a-helix domain regulates substrate

binding [4–6]

Hsp105a and Hsp105b are mammalian members of

the Hsp105⁄ 110 family, a divergent subgroup of the

Hsp70 family Hsp105a is expressed constitutively and

induced by various forms of stress, whereas Hsp105b

is an alternatively spliced form of Hsp105a that is

expressed specifically during mild heat shock [7–9]

These proteins suppress the aggregation of denatured

proteins caused by heat shock in vitro, as does

Hsp70⁄ Hsc70, but they have yet to be found to have

refolding activity [10] In addition, Hsp105a and

Hsp105b were suggested to function as a substitute for

Hsp70 family proteins to suppress the aggregation of

denatured proteins in cells under severe stress, in which

the cellular ATP level decreases markedly [11] In a

preceding report, we showed that Hsp105a localizes in

the cytoplasm of mammalian cells, whereas Hsp105b

localizes in the nucleus [12] Furthermore, Hsp105b,

but not Hsp105a, induces the expression of Hsp70 in

mammalian cells [13]

In this study, we showed that Hsp105b-mediated

Hsp70 induction was regulated by signal transducer

and activator of transcription (STAT)-3 but not heat

shock factors (HSFs) Furthermore, Hsp105b seemed

to upregulate Hsp70 expression in heat-shocked cells

Results

Nuclear localization of Hsp105b is necessary

but not sufficient for activation of the hsp70

promoter

In preceding reports, we have shown that Hsp105b, but

not Hsp105a, localizes to the nucleus and induces the

expression of Hsp70 in mammalian cells [12,13] To

elu-cidate the mechanism by which Hsp105b induces the

expression of Hsp70, a series of plasmids that expressed

C-terminal deletion mutants of Hsp105b were

cotrans-fected into COS-7 cells with the reporter plasmid

pGL70()2616) (Fig 1A) As shown in Fig 1B,

Hsp105b(1–756), lacking the C-terminal 58 amino

acids, showed an approximately 10-fold induction in

luciferase activity, similar to full-length Hsp105b

Furthermore, Hsp105b(1–698), Hsp105b(1–677) and

Hsp105b(1–662) induced approximately 60% of the

luciferase activity as compared with the control

How-ever, Hsp105b(1–641), Hsp105b(1–591), and Hsp105b

(1–564), lacking more than the C-terminal 173 amino

acids of Hsp105b, failed to induce luciferase activity

As Hsp105b(D642–698), which lacked the region between amino acids 642 and 698, also failed to induce the luciferase activity, the region between amino acids

642 and 662 of Hsp105b seemed to be necessary for activation of the hsp70 promoter Furthermore, Hsp105bmNLS, in which several amino acids in the nuclear localization signal (NLS) sequence of Hsp105b were replaced, also failed to activate the hsp70 promoter, as described previously [13]

We next examined the cellular localization of the deletion mutants of Hsp105b in COS-7 cells by indirect immunofluorescence, using antibody against myc-tag

As shown in Fig 1C, Hsp105b localized to the nucleus

of cells, but Hsp105bmNLS, which failed to activate the hsp70 promoter, localized to the cytoplasm of cells

In addition, Hsp105b(1–756), which activates the hsp70 promoter like Hsp105b, localized mainly to the nucleus

of cells, whereas Hsp105b(1–698), Hsp105b(1–677), and Hsp105b(1–662), which activate the hsp70 pro-moter to approximately 60% of the extent to which it

is activated by Hsp105b, localized not only to the nucleus but also to the cytoplasm of cells However, Hsp105b(1–641), Hsp105b(1–591), and Hsp105b(D642– 698), which failed to activate the hsp70 promoter, also localized to the nucleus and cytoplasm Interestingly, Hsp105b(1–564) localized mainly to the nucleus of cells, like Hsp105b, although it failed to activate the hsp70 promoter These results suggest that the nuclear localization of Hsp105b was necessary but not suffi-cient for the Hsp105b-induced expression of the hsp70 gene

The promoter region between)206 and )187 bp

of the hsp70 gene is essential for activation of the hsp70 promoter by Hsp105b

To identify the hsp70 promoter region that is necessary for the induction of Hsp70 by Hsp105b, a series of hsp70 5¢-promoter deletion-luciferase constructs were generated and transiently transfected into COS-7 cells with the Hsp105b expression plasmid (Fig 2A) As shown in Fig 2B, although Hsp105b enhanced the activity of hsp70 promoter deleted up to )218 bp, further deletion of the hsp70 promoter up to )194 bp abolished the responsiveness to Hsp105b Furthermore,

we found two putative heat shock elements (HSEs) (5¢-NGAAN-3¢) and two putative STAT3-binding ele-ments (5¢-CTGGRA-3¢) in the region between)206 and )187 bp of the hsp70 promoter through transcription factor database (TRANSFAC; http:⁄ ⁄ www.biobase-international.com⁄ pages ⁄ index) searches (Fig 2A) When the pGL70(–218)mut construct with five mutated bases within these elements were transiently

A B

C

transfected into COS-7 cells with the Hsp105b

expres-sion plasmid, the activation of the hsp70 promoter by

Hsp105b was not observed (Fig 2B) On the other

hand, after deletion of the sequence of the hsp70

pro-moter to )194 bp, responsiveness to heat shock was

retained, and the heat inductivity of the hsp70

pro-moter was dependent on the length of the 5¢-flanking

sequence of the hsp70 gene (Fig 2C) Thus, Hsp105b

seemed to activate the hsp70 promoter by a mechanism

different from the heat-induced activation of hsp70

promoter, and the region between )206 and )187 bp

of the hsp70 promoter is necessary for

Hsp105b-induced expression of the hsp70 gene

STAT3, but not HSF1, binds to the region

between)206 and )187 bp of the hsp70

promoter

Next, we investigated protein binding to the region

between )206 and )187 bp of the hsp70 promoter,

using a biotin-mediated oligonucleotide pull-down

assay (Fig 3A) When the extracts from the cells

over-expressing Hsp105b were incubated with a biotinylated

oligonucleotide probe, GL70, containing the sequence

from)212 to )185 bp of the hsp70 promoter, STAT3

was found to bind to the GL70 oligonucleotide but not

the GL70mt oligonucleotide, which was mutated in the

HSF1⁄ STAT3 consensus sequences On the other hand,

HSF1 binding to GL70 or GL70mt was not observed

To further examine whether STAT3 bound to the

hsp70 promoter in vivo, chromatin

immunoprecipita-tion analyses were performed using HeLa-tet⁄ Hsp105b

cells (Fig 3B) In the cells incubated with doxycycline

(DOX), the chromatin containing the hsp70 promoter

fragment was not coimmunoprecipitated with STAT3

antibody However, when Hsp105b was overexpressed,

the binding of STAT3 to the region between)272 and

)13 bp of the hsp70 promoter was observed using

STAT3 antibody, whereas the hsp70 promoter

frag-ment was not detected using normal rabbit IgG

How-ever, STAT3 did not bind to the region between)1860

and)1656 bp of the hsp70 promoter In addition, the

chromatin containing the hsp70 promoter fragment was pulled down by acetylated histone H4 antibody, regardless of Hsp105b overexpression, suggesting that Hsp105b did not affect the basal histone H4 acetyla-tion of the hsp70 promoter These results suggested that STAT3 binds directly to the region between )206 and )187 bp of the hsp70 promoter in vitro and

in vivo, resulting in the induction of Hsp70 expression

STAT3 is required for the induction of hsp70 promoter activity by Hsp105b

To further demonstrate that STAT3 plays essential roles in the activation of the hsp70 promoter by Hsp105b, STAT3 expression was downregulated by a small interfering RNA (siRNA) method In the experi-ment, we used human HEK293 cells in which STAT3 expression was effectively downregulated by the STAT3 siRNA, and monkey COS-7 cells in which it was not The transfection of STAT3 siRNA decreased STAT3 expression by up to approximately 25% in the cells, and the Hsp105b-mediated hsp70 promoter activation was significantly suppressed by the STAT3 siRNA but not by control siRNA (Fig 4) These results further suggested that STAT3 mediates Hsp105b-induced expression of the hsp70 gene

STAT3 is activated by tyrosine phosphorylation at Tyr705, which induces dimerization, nuclear transloca-tion, and DNA binding [14–16] We next examined whether Hsp105b stimulated the phosphorylation of STAT3 at Tyr705 using antibody against phospho-STAT3 (Tyr705) When HeLa-tet⁄ Hsp105b cells were treated with interferon a (INFa), an activator of the Janus kinase (JAK)–STAT pathway, STAT3 was phos-phorylated at Tyr705 and translocated into the nucleus

in cells incubated with or without DOX (Fig 5A,B) Furthermore, when Hsp105b was overexpressed in HeLa-tet⁄ Hsp105b cells, STAT3 was phosphorylated and translocated into the nuclei without INFa treat-ment (Fig 5A,B), suggesting that Hsp105b stimulates the phosphorylation of STAT3 at Tyr705 and trans-location into the nuclei of cells

Fig 1 The region between amino acids 642 and 662 of Hsp105b is necessary for activation of the hsp70 promoter by Hsp105b (A) Sche-matic representation of a series of C-terminal deletion mutants of Hsp105b The asterisk in the Hsp105bmNLS mutant indicates the location

of the mutated NLS sequence (B) The expression plasmids for Hsp105b and its deletion mutants were cotransfected with the pGL70( )2616) reporter construct into COS-7 cells, and luciferase activities were measured To estimate the transfection efficiency of these plasmids, the levels of a series of C-terminal deletion mutants of Hsp105b and a-tubulin were determined by western blotting using antibod-ies against myc-tag and a-tubulin, respectively Relative activity is expressed as ratio to that of cells cotransfected with pGL70( )2616) plas-mid and pcDNA3.1(+)myc⁄ His vector Values represent the means ± standard deviations of four independent experiments, and asterisks indicate significant differences (*P < 0.01, **P < 0.05) (C) The expression plasmids for Hsp105b and its deletion mutants were transfected into COS-7 cells At 48 h after transfection, cells were stained with Hoechst 33342 (blue), and the intracellular distribution of Hsp105b and its mutants was determined by indirect immunofluorescence microscopy using antibody against myc-tag (red).

Downregulation of Hsp105 reduces the induction

of Hsp70 expression during heat shock

To elucidate the physiological role of

Hsp105b-medi-ated regulation of Hsp70 expression, we examined

whether Hsp105 affects Hsp70 expression during heat shock at 42 C, at which temperature Hsp105b is induced As shown in Fig 6, when HeLa-tet⁄ Hsp105b cells were treated at 42C for 5 h, Hsp105b was induced at 5 h, and the expression of Hsp70 increased

A

Fig 2 The hsp70 promoter region between )218 and )194 bp is required for activation of the hsp70 promoter by Hsp105b (A) Schematic representation of 5¢-serial deletions of the hsp70 promoter reporter constructs (B) The expression plasmid for Hsp105b was cotransfected with the constructs in (A), and luciferase activities were measured (C) COS-7 cells were transfected with the constructs in (A) At 48 h after transfection, cells were treated at 45 C for 10 min, and then maintained at 37 C for 8 h Luciferase activities were then measured Relative activities in (B) and (C) are expressed as ratios to that of cells transfected with pGL70( )2616) plasmid and pcDNA3.1(+)myc ⁄ His vector Values represent the means ± standard deviations of three independent experiments, and the asterisks represent significant differences

at P < 0.01.

gradually and markedly at 5 h However, when

Hsp105 expression was downregulated by Hsp105

siR-NA, accumulation of Hsp70 at 5 h was suppressed

during heat shock at 42C Furthermore, the

heat-induced Hsp70 was reduced by the downregulation of

STAT3 (Fig 7) Thus, Hsp105b seemed to enhance the

expression of Hsp70 during mild heat shock

condi-tions

Discussion

We have shown that Hsp105b, but not Hsp105a,

local-izes to the nucleus and induces the expression of

Hsp70 in mammalian cells [12,13] Here, we examined the mechanism by which Hsp105b induces the expres-sion of Hsp70, and showed that Hsp105b induces the expression of Hsp70 through the transactivation of STAT3 in mammalian cells Indeed, it was found that STAT3 bound to the sequence between )206 and )187 bp of the hsp70 promoter, and mutation of the conserved motif for STAT3 binding in this region abrogated activation of the hsp70 promoter by Hsp105b Furthermore, downregulation of STAT3 expression resulted in reduced Hsp105b-induced expression of the hsp70 gene

B

A

Fig 3 STAT3, but not HSF1, binds to the region between )206

and )187 bp of the hsp70 promoter (A) HeLa-tet ⁄ Hsp105b cells

were grown in medium without DOX for a period of 48 h Extracts

from these cells were incubated with biotinylated GL70 or GL70mt

oligonucleotides After unbound proteins were removed by

wash-ing, proteins bound to the oligonucleotides were eluted with

excess biotin and detected by western blotting, using antibody

against STAT3 or HSF1 The input represented 5% of the protein

used in the pull-down assay (B) Chromatin immunoprecipitation

analysis was performed with chromatin extracts from

HeLa-tet ⁄ Hsp105b cells grown in medium with or without DOX for a

period of 48 h DNAs from chromatins immunoprecipitated with

an antibody against STAT3, acetylated histone H4 or normal rabbit

IgG were amplified by PCR with two sets of specific primers for

the hsp70 promoter The input represents 5% of the material used

in the chromatin immunoprecipitation assays Similar results were

obtained with two independent experiments.

A

B

Fig 4 STAT3 is required for activation of the hsp70 promoter by Hsp105b The expression plasmid for Hsp105b was cotransfected with pGL70( )2616) plasmid and STAT3 or control siRNA into HEK293 cells (A) At 48 h after transfection, cells were harvested, and STAT3, Hsp105b and a-tubulin were detected by western blot-ting, using the respective antibodies (B) Luciferase activity was measured as hps70 promoter activity Relative activity is expressed

as a ratio to that of cells cotransfected with control siRNA, pGL70( )2616) plasmid, and pcDNA3.1(+)myc ⁄ His vector Values represent the means ± standard deviations of four independent experiments, and the asterisks indicate significant differences at

P < 0.01.

The major regulators of hsp gene expression are

HSFs, which form a multimember protein family in

vertebrates [17] Each HSF seems to have special

func-tions in response to distinct stimuli under normal or

stressed conditions HSF1 is a typical transcription

fac-tor, and is responsive to various stresses, such as heat

shock [18] Under nonstress conditions, HSF1 exists in

an inactive form as a monomer; in response to stress,

it forms homotrimers that bind to the HSEs in the

promoter regions of hsp genes [19] In addition, an inflammatory cytokine, interleukin-6, induces the exp-ression of Hsp70 and Hsp90b via STAT-like binding

A

B

Fig 5 Activation of STAT3 and nuclear translocation by Hsp105b.

HeLa-tet ⁄ Hsp105b cells were incubated with or without DOX for

48 h, and were treated without or with 100 ngÆmL)1 INFa for

10 min (A) Phosphorylated STAT3 (Tyr705) (p-STAT3), STAT3,

Hsp105, Hsp70 and a-tubulin were analyzed by western blotting,

using the respective antibodies (B) These cells were stained with

Hoechst 33342 (blue), and the intracellular distribution of

phosphor-ylated STAT3 was determined by indirect immunofluorescence

microscopy using antibody against phospho-STAT3 (red).

A

B

C

Fig 6 Hsp105b upregulates the expression of Hsp70 during mild heat shock (A) Hsp105 or control siRNA was transfected into HeLa-tet ⁄ Hsp105b cells grown in medium with DOX At 48 h after transfection, the cells were treated at 42 C for 5 h, and the expression of Hsp105, Hsp70 and a-tubulin was analyzed by wes-tern blotting, using the respective antibodies (B, C) The density of bands was quantified by densitometry, and was corrected with the density of a-tubulin as loading control Relative levels of Hsp70 (B) and Hsp105b (C) are represented as ratios of respective levels in the cells heat-shocked at 42 C for 5 h with transfection of control siRNA Values represent the means ± standard deviations of three independent experiments, and the asterisks indicate significant differences at P < 0.01.

sites that are located close to the HSEs in the hsp70

and hsp90b promoters The activation of hsp

promot-ers is mediated through the STAT3 signaling pathway

[20] STAT1 also enhances the activation of hsp70 and

hsp90promoters [21] As we showed, in this study, that

STAT3 directly bound to the region between)206 and

)187 bp of the hsp70 promoter and enhanced the

expression of the hsp70 gene in the cells overexpressing

Hsp105b, STAT family proteins seem to play an

important role in the regulation of hsp gene

expres-sion

STAT family proteins are present in a latent,

mono-meric form in the cytoplasm, and are activated by

specific tyrosine phosphorylation by JAK family

mem-bers The phosphorylation of STATs leads to homodi-merization or heterodihomodi-merization, and the STATs then migrate to the nuclei of cells to activate target gene expression [14–16] We showed here that Hsp105b stimulated the phosphorylation of STAT3 at Tyr705 and its translocation into the nucleus Hsp105b seems not to activate JAKs directly, as JAKs localize mainly into the cytoplasm As Hsp105a, which localizes in the cytoplasm of cells, did not enhance the expression of Hsp70, Hsp105b may activate unknown factor(s) in the nucleus, which stimulate the phosphorylation of STAT3 by JAKs Further studies are required to elucidate the precise mechanisms by which Hsp105b activates STAT3

HSP105⁄ 110 family proteins are suggested to pre-vent the aggregation of denatured proteins caused by heat shock in vitro, as does Hsp70⁄ Hsc70 [10,22,23] More recently, mammalian Hsp105⁄ 110 and the yeast homologs Sse1p⁄ 2p have been shown to act as efficient nucleotide exchange factors for Hsp70 and its ortho-logs in Saccharomyces cerevisiae, Ssa1p and Ssb1p, respectively, and enhance Hsp70-mediated chaperone activity [24–26] However, although HSP105 family proteins are important components of the Hsp70 chap-erone machinery, excess Hsp110 seems to have a nega-tive effect on Hsp70-mediated chaperone activity, owing to it accelerating substrate cycling to such an extent that the reaction becomes unproductive for fold-ing [25] Hsp105b-induced expression of Hsp70 may be important for Hsp70-mediated protein refolding by the correction of the ratio between Hsp105 and Hsp70 chaperones in the cells Furthermore, as Hsp105b is necessary for the marked expression of Hsp70 under mild heat shock conditions, Hsp105b seems to play an important role in protection against deleterious stres-sors by Hsp70 Although further study will be required

to clarify the mechanisms by which Hsp105b induces the activation of STAT3, the present findings may pro-vide clues to the cellular function of HSP105 family proteins in the chaperone network of mammalian cells

Experimental procedures

Antibodies The following antibodies were used for western blotting, immunofluorescence, and gel shift experiments: Hsp105, rabbit (human Hsp105 IgG) [27]; Hsp70, mouse anti-(human Hsp70 IgG), which only reacted with inducible Hsp70 (clone C92F3A-5; Stressgen, Ann Arbor, MI, USA); myc tag, mouse anti-myc IgG (Invitrogen, Carlsbad, CA, USA); HSF1, rabbit anti-(human HSF1 IgG) (Stressgen); STAT3, rabbit anti-(mouse STAT3 IgG) (K-15; Santa Cruz

A

B

Fig 7 Requirement of STAT3 for the induction of Hsp70 during

mild heat shock (A) STAT3 or control siRNA was transfected into

HeLa-tet ⁄ Hsp105b cells grown in medium with DOX At 48 h after

transfection, the cells were treated at 42 C for 5 h, and the

expression of STAT3, Hsp70 and a-tubulin was analyzed by

wes-tern blotting, using the respective antibodies (B) The density of

bands was quantified by densitometry, and was corrected with the

density of a-tubulin as loading control Relative levels of Hsp70 are

represented as ratios of respective levels in the cells heat-shocked

at 42 C for 5 h with transfection of control siRNA Values

repre-sent the means ± standard deviations of three independent

experi-ments, and the asterisks indicate significant differences at

P < 0.01.

Biotechnology, Santa Cruz, CA, USA); phosphorylated

STAT3, rabbit anti-[phospho-STAT3 (Tyr705) IgG] (D3A7;

Cell Signaling Technology, Danvers, MA, USA); a-tubulin,

mouse anti-a-tubulin IgG (clone DM1A; Sigma, Saint

Louis, MI, USA)

Cells

African green monkey kidney COS-7 cells and human

embryonic kidney HEK293 cells were obtained from the

RIKEN Bioresource Center Cell Bank (Tsukuba, Japan)

HeLa-tet⁄ Hsp105a and HeLa-tet ⁄ Hsp105b cells, which

express either mouse Hsp105a or Hsp105b by removing

DOX from the culture medium, have been described

previ-ously [28] These cells were maintained in DMEM

supple-mented with 10% fetal bovine serum at 37C with 95% air

and 5% CO2

Plasmids

The expression plasmids for mouse Hsp105a, Hsp105b and

a mutant with substitutions in the NLS or a series of

C-terminal deletion mutants of Hsp105b in mammalian

cells have been described previously [12,13,29] The

construc-tion of the reporter plasmid pGL70()2616), which contains

the firefly luciferase cDNA driven by a human hsp70

pro-moter sequence from )2616 to +150, has been described

previously [13] A series of 5¢-deletions of the human hsp70

promoter sequence were generated by self-ligation of the

DNA sequence made by PCR, with pGL70()2616) as the

template DNA and a specific set of primers (Table 1) The

substitution construct of pGL70()218) was made using a

QuickChange site-directed mutagenesis kit (Stratagene, La

Jolla, CA, USA), according to the manufacturer’s

instruc-tions The following oligonucleotides were used as primers

for mutagenesis: 5¢-CAG AAC TCT CCA GAG TCT GAT

GAG ATC TAC TGG AGG GGA CAG GGT T-3¢ and

5¢-AAC CCT GTC CCC TCC AGT AGA TCT CAT

CAG ACT CTG GAG AGT TCT G-3¢ (substituted

nucleo-tides underlined)

Western blotting

Cells (5· 105

cells per 35 mm diameter dish) were lysed

with 0.1% SDS and boiled for 5 min Aliquots (20 lg of

protein) of cell extracts in SDS sample buffer (62.5 mm

Tris⁄ HCl, pH 6.8, 10% glycerol, 2% SDS, 5%

2-mercapto-ethanol, 0.00125% bromophenol blue) were subjected to

SDS⁄ PAGE, and then transferred to nitrocellulose

mem-branes by electrotransfer The memmem-branes were blocked

with 5% skimmed milk in Tris-buffered saline (20 mm

Tris⁄ HCl, pH 7.6, 137 mm NaCl) containing 0.1%

Tween-20, and incubated with the indicated primary antibodies

Then, the membranes were incubated with horseradish

peroxidase-conjugated anti-rabbit IgG or anti-mouse IgG, and the antibody–antigen complexes were detected using a western blot luminol reagent (Santa Cruz Biotechnology)

Measurement of hsp70 promoter activity For the transfection of reporter constructs, COS-7 cells in 24-well plates (7· 104

cells per well) were grown and washed twice with Opti-MEM The cells were then trans-fected with 1.5 lg of reporter plasmid and 0.75 lg of the expression vector for Hsp105b or its deletion constructs by lipofection, using DMRIE-C reagent according to the man-ufacturer’s instructions (Invitrogen) At 48 h after transfec-tion, the cells were lysed with the cell culture lysis reagent (Promega, Madison, WI, USA), and aliquots of the cell extracts were subjected to measurement of luciferase activ-ity, as described previously [11] The protein concentration

of the cell lysates was also determined, to normalize for protein content For the knockdown of STAT3 expression,

10 pmol of the STAT3 siRNA (Santa Cruz Biotechnology)

or RISC-free control siRNA (Dharmacon, Chicago, IL, USA) was cotransfected into HEK293 cells with 1.5 lg of reporter plasmid and 0.75 lg of the expression vector for Hsp105b, using Lipofectamine 2000, according to the manufacturer’s instructions (Invitrogen)

Indirect immunofluorescence Cells grown on collagenized coverslips (2· 104

cellsÆcm)2in 24-well plates) were fixed with 4% paraformaldehyde for

30 min at room temperature and permeabilized with ice-cold methanol for 10 min After being washed twice with NaCl⁄ Pi, the cells were incubated with blocking solution (NaCl⁄ Pi containing 5% BSA) at 37C for 1 h Then, the cells were incubated with mouse anti-myc Ig (1 : 100) or rabbit anti-phospho-STAT3 (Tyr705) IgG for 1–2 h at

37C After multiple washes with NaCl ⁄ Pi, the cells were

Table 1 Primers used for construction of 5¢-serial deletions of hsp70 promoter reporter constructs.

Plasmid Orientation Sequence (5¢- to 3¢) pGL70( )1194) Sense GGAGGTGGAGCAATTAGCCG

Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70( )800) Sense CTTTCCCCAAGTGCTCCTCCTA

Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70( )405) Sense TGGACGCGCGTAACCCGCAC

Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70( )298) Sense GCGCTGAAGCGCAGGCGGTCA

Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70( )218) Sense TGTCCCCTCCAGTGAATCCCAGA

Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70( )194) Sense ACTCTGGAGAGTTCTGAGCAG

Antisense GGGTTATGTTAGCTCAGTTACAGTA

incubated with rhodamine-conjugated anti-mouse IgG or

rhodamine-conjugated anti-rabbit IgG (1 : 50; Molecular

Probes, Eugene, OR, USA) for 1–2 h at 37C, and stained

with 10 lm Hoechst 33342 for 10 min in the dark After

multiple washes with NaCl⁄ Pi, the cells were observed using

a confocal laser scanning microscope (LSM410; Zeiss, Jena,

Germany)

Biotin-mediated oligonucleotide pull-down assay

Whole cell extracts were prepared by lysing cells with

extraction buffer as described previously [30] Two

milli-grams of whole cell extract was incubated with 0.5 nmol of

biotinylated double-stranded oligonucleotide (GL70,

5¢-bio-tin-CTC CAG TGA ATC CCA GAA GAC TCT GGA

G-3¢; GL70mt, 5¢-biotin-CTC CAG TAG ATC TCA AGA

GAC TCT GGA G-3¢) in binding buffer [50 mm Tris ⁄ HCl,

pH 7.8, 100 mm NaCl, 1.5 mm MgCl2, 1 mm EDTA, 0.1%

NP-40, 10% (v⁄ v) glycerol, 0.5 mgÆmL)1 salmon sperm

DNA] at 4C for 30 min The samples were precleared

with CL-4B Sepharose at 4C for 30 min, and the

remain-ing DNA was precipitated with 30 lL of a 50% slurry of

Ultralink streptavidin gel (Pierce, Rockford, IL, USA) at

4C for 1 h Bound fractions were washed five times with

binding buffer, and DNA-bound proteins were eluted with

binding buffer containing 1 mgÆmL)1 biotin; this was

fol-lowed by SDS⁄ PAGE and western blotting

Chromatin immunoprecipitation

HeLa-tet⁄ Hsp105b cells were grown in medium with or

without DOX for a period of 48 h and subjected to

chro-matin immunoprecipitation analysis Cells (5· 107cells)

were cross-linked with a final concentration of 1%

for-maldehyde for 8 min at room temperature, and this was

followed by quenching with a final concentration of 0.25 m

glycine The cell pellets were then collected by

centrifuga-tion (450 g, 4C, 5 min) and washed three times with lysis

buffer (10 mm Tris⁄ HCl, pH 7.5, 10 mm NaCl, 3 mm

MgCl2, 0.5% NP-40) The lysates were then sonicated on

ice to generate chromatin fragments with an average DNA

length of 500 bp Immunoprecipitation was performed after

preclearing with salmon sperm DNA saturated protein

A–agarose beads at 4C overnight using anti-mouse STAT3

IgG (K-15; Santa Cruz Biotechnology), acetylated histone

H4 serum (positive control; #06-866; Upstate Biotechnology,

Lake Placid, NY, USA), or normal rabbit IgG (negative

con-trol) The immunocomplexes were washed three times in

buf-fer A (50 mm Hepes⁄ KOH, pH 7.5, 1 mm EDTA, 1%

Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS)

con-taining 150 mm NaCl, twice in buffer A concon-taining 500 mm

NaCl, twice in buffer B (10 mm Tris⁄ HCl, pH 8.0, 250 mm

LiCl, 1 mm EDTA, 0.5% NP-40, 0.1% sodium

deoxycho-late), and finally once in TE buffer (10 mm Tris⁄ HCl, pH

8.0, 1 mm EDTA) The immunoprecipitated chromatin was

then eluted with elution buffer (50 mm Tris⁄ HCl, pH 7.5,

10 mm EDTA, 1% SDS), and DNA–protein cross-links were removed by incubating with a final concentration of

2 mgÆmL)1pronase at 65C for 6 h Then, DNA was puri-fied using a QIAquick PCR Purification Kit (Qiagen, Hilden, Germany) Immunoprecipitated DNA and input samples obtained prior to immunoprecipitation were analyzed by PCR (35 cycles of 94C for 15 s, 60 C for 15 s, and 72 C for 30 s), using a set of specific primers for the human hsp70 gene between )272 and )13 (forward, 5¢-CCA TGG AGA CCA ACA CCC T-3¢; reverse, 5¢-CCC TGG GCT TTT ATA AGT CGT-3¢), or the human hsp70 gene between )1860 and )656 (forward, 5¢-TCT ATC TCT CGA TGG ATA CAG A-3¢; reverse, 5¢-AGG ACA GTA GAA TTA GGT CAC T-3¢)

Knockdown of Hsp105a and Hsp105b The double-stranded RNA targeting Hsp105 (Dharmacon; 5¢-GCA AAU CAC UCA UGC AAA CUU-3¢) was resus-pended to make a 20 lm solution, following the manufac-turer’s instructions siRNA transfections were carried out using siLentFect reagent, according to the manufacturer’s instructions (Bio-Rad, Hercules, CA, USA) At 72 h after transfection, cells were harvested for western blotting

Statistical analysis The significance of differences was assessed using an unpaired Student’s t-test A probability level (P) of less than 0.05 was considered to be statistically significant

Acknowledgements

This study was supported in part by a Grant-in-Aid for Scientific Research (C) (No 1750903) and Young Scientists (B) (No 17790077), and a grant for the Frontier Research Program of Kyoto Pharmaceutical University from the Ministry of Education, Science, Sports and Culture of Japan

References

1 Samali A & Orrenius S (1998) Heat shock proteins: regulators of stress response and apoptosis Cell Stress Chaperones 3, 228–236

2 Hendrick JP & Hartl F-U (1993) Molecular chaperone functions of heat-shock proteins Annu Rev Biochem 62, 349–384

3 Bukau B & Horwich AL (1998) The Hsp70 and Hsp60 chaperone machines Cell 92, 351–366

4 McCarty JS, Buchberger A, Reinstein J & Bukau B (1995) The role of ATP in the functional cycle of the DnaK chaperone system J Mol Biol 249, 126–137