Tài liệu Báo cáo khoa học: The miRNA-192 ⁄194 cluster regulates the Period gene family and the circadian clock doc

In addition to transcriptional regulation, several studies have shown that post-transcriptional processes Keywords circadian clock; miRNA-192; miRNA-194; Period gene family Correspondenc

family and the circadian clock

Remco Nagel1, Linda Clijsters1and Reuven Agami1,2

1 Division of Gene Regulation, The Netherlands Cancer Institute, Amsterdam, The Netherlands

2 Center for Biomedical Genetics, The Netherlands

Introduction

Daily oscillations of physiological and behavioural

processes can be observed in diverse organisms,

rang-ing from the filamentous fungus Neurospora crassa to

humans The oscillating rhythms are driven by an

internal timing mechanism called the circadian clock

In mammals, the circadian system is organized as a

hierarchical network of molecular clocks that operate

in different tissues, with the master clock residing in

the suprachiasmatic nucleus (SCN) in the

hypothala-mus The master clock itself is synchronized by means

of external cues from the daily light⁄ dark cycles, and

transmits information regarding its phase to multiple

tissue-specific clocks [1] The molecular machinery

underlying the circadian rhythm, which is present in

each individual cell, is thought to be composed of

self-sustaining transcriptional feedback loops The core of

the molecular pathway regulating circadian oscillations

is the CLOCK⁄ BMAL1 complex [2,3] This

hetero-dimeric complex functions as a transcription factor

that is able to induce the expression of circadian out-put genes, also called clock-controlled genes (CCGs), via E-box enhancer elements in their promoters [4] Amongst the CCGs are also the negative regulators of CLOCK⁄ BMAL1, the family of Period genes (Per1, Per2 and Per3), the Cryptochromes (Cry1 and Cry2) and Rev-Erba [3,5,6] Rev-Erba binds the BMAL1 promoter directly to inhibit BMAL1 transcription, resulting in reduced CLOCK⁄ BMAL1 levels and decreased CCG expression [7] This mode of repression leads to the cycling of BMAL1 mRNA levels in an anti-phase fashion to that of the CCGs When the other negative regulators of BMAL1, the Per and Cry proteins, are at their peak levels in the nucleus, they function in complexes to suppress E-box-dependent gene activation [5] In this way, the molecular circa-dian clock is reset and a new cycle can be started

In addition to transcriptional regulation, several studies have shown that post-transcriptional processes

Keywords

circadian clock; miRNA-192; miRNA-194;

Period gene family

Correspondence

R Agami, Division of Gene Regulation, The

Netherlands Cancer Institute, Plesmanlaan

121, 1066CX, Amsterdam, The Netherlands

Fax: +31(0)20 512 1999

Tel: +31(0)20 512 2079

E-mail: r.agami@nki.nl

(Received 17 June 2009, revised 15 July

2009, accepted 22 July 2009)

doi:10.1111/j.1742-4658.2009.07229.x

Several biological functions in mammals are regulated in a circadian fash-ion The molecular mechanisms orchestrating these circadian rhythms have been unravelled The biological clock, with its core transcriptional unit Bmal1⁄ CLOCK, is composed of several self-sustaining feedback loops In this study, we describe another mechanism impinging on the core compo-nents of the circadian clock Using a forward genetic screen, we identified the miR-192⁄ 194 cluster as a potent inhibitor of the entire Period gene family In accordance, the exogenous expression of miR-192⁄ 194 leads to

an altered circadian rhythm Thus, our results have uncovered a new mech-anism for the control of the circadian clock at the post-transcriptional level

Abbreviations

CCG, clock-controlled gene; Cry, Cryptochrome; GAPDH, glyceraldehyde-3-phosphate dehydrogenase; GFP, green fluorescent protein; miRNA, microRNA; Per, Period; SCN, suprachiasmatic nucleus.

are of major importance in the control of the circadian

clock The phosphorylation and degradation of Per

proteins have been suggested to control timing of the

mammalian clock [8] Moreover, BMAL1 and Cry

proteins are subject to phosphorylation, SUMOylation

and proteasomal degradation, thereby controlling their

activity at the post-transcriptional level [9–11]

Recently, a new class of post-transcriptional

regula-tors, called microRNAs (miRNAs), has been shown to

possess regulatory functions towards the circadian

clock miRNAs are single-stranded, nonprotein-coding

RNA molecules, approximately 19–25 nucleotides in

length By binding to the complementary sites in the

3¢UTRs of their target genes, they can induce

transla-tional inhibition or mRNA decay miRNAs have been

shown to be involved in many cellular processes,

including the control of the circadian clock [12] In a

comprehensive study, Cheng et al [12] showed that

miR-132 and miR-219 are expressed rhythmically in

the SCN and are bona fide CCGs Interestingly,

miR-219 was shown to fine tune the length of the circadian

period in mice, whereas miR-132 was suggested to be a

negative regulator of the light-dependent resetting of

the clock itself

In this study, we have uncovered a role for a cluster

of miRNAs in the control of core components of the

circadian clock Using a forward genetic screen to

dis-cover miRNAs with regulatory capacities towards the

3¢UTRs of all the Per family members (Per1, Per2 and

Per3), we identified an miRNA cluster containing

miR-192 and miR-194 (miR-192⁄ 194) as powerful

reg-ulators The strong expression level of this cluster

potently inhibits the synthesis of all three Per

mem-bers, resulting in an altered circadian rhythm

Results

miR-192 and miR-194 target all three Per genes

In order to identify miRNA regulators of the Per gene

family members, Per1, Per2 and Per3, we cloned their

respective 3¢UTRs downstream of a green fluorescent

protein (GFP) coding sequence in a sensor vector

described previously [13,14] The constructed vectors

were delivered retrovirally to HeLa cells, after which

single clones with a defined level of GFP expression

were isolated The constructed cell lines were

subse-quently transduced with a microRNA expression

library (miR-Lib; [13]) in a single-well format, drug

selected and pooled To identify possible regulatory

miRNAs towards the inserted 3¢UTRs, the three pools

of cells containing one unique GFP reporter were

fluo-rescence-activated cell sorted on their GFP expression

levels The relative abundance of miRNA inserts between the low-GFP-expressing population and the total population was measured by a barcode-type anal-ysis using our miRNA arrays We observed in the resulting M–A plots that only a few miRNAs were reproducibly enriched in the low-GFP-expressing pop-ulation (Fig 1A–C) The most striking observation was that the most highly enriched miRNA expression vector (miR-Vec) for all three individual 3¢UTRs was the vector encoding the miR-192⁄ 194 cluster (Fig 1A–F)

To confirm that the obtained hits from the GFP UTR screens indeed have regulatory capacities against the 3¢UTR of the Per genes, we retested their effects

on the original HeLa cell line expressing the GFP sen-sor constructs We observed that miR-192⁄ 194 inhib-ited GFP expression of all the sensor constructs, whereas all the other obtained hits could not signifi-cantly downregulate any of the GFP-Per sensors (Fig 2A–C and data not shown) To exclude the possi-bility that miR-192⁄ 194 regulates a common sequence

in the GFP sensor construct, we subcloned the 3¢UTR

of Per1–3 into a luciferase vector In addition, these vectors were reduced by about 30% in comparison with the control, indicating that the sequences regu-lated by miR-192⁄ 194 indeed reside in the 3¢UTRs of the Per1–3 genes (Fig 2D)

A close examination of the 3¢UTR of the Per genes

by TargetScanHuman 5.0 [15] revealed that all of these sequences harbour putative target sites for miR-192 or miR-194 Whereas the Per1 3¢UTR contains one predicted target site for miR-194, Per2 has a site for miR-192 as well as miR-194, and Per3 harbours one putative site for miR-192 and two for miR-194 (Fig 3A) As predicted, all of these target sites are well conserved between mammalian species, implying a pos-sible common regulatory mechanism To show that the miR-192⁄ 194 cluster indeed regulates the 3¢UTRs of the Per genes via these predicted target sites, we mutated all of these sequences In transient transfec-tion experiments, these mutated 3¢UTRs were com-pletely refractory to regulation by the miR-192⁄ 194 cluster, indicating the direct suppression of Per1, 2 and

3 by these miRNAs (Fig 3B–D) Together, these data indicate that the miR-192⁄ 194 cluster is a potent and direct regulator of the Per gene family

Endogenously expressed miR-192⁄ 194 represses Per

As it has been reported previously that miR-192⁄ 194 is highly expressed in colorectal cancer cell lines and tumours [16], we attempted to exploit these cells to

determine the endogenous role of miR-192⁄ 194 The

examination of 12 colorectal cell lines indicated a

het-erogeneous level of miR-192⁄ 194, ranging from very

low in HCT116, Colo320 and SW48 cells, to high in

LOVO, HT29 and LS174T cells (Fig S1, see

Support-ing information) We made use of the different Per

luciferase 3¢UTR constructs to detect miR-192 ⁄ 194

activity In transient transfection assays with these

con-structs containing wild-type and mutant Per 3¢UTRs,

we observed reduced expression of all three wild-type

3¢UTRs only in cell lines with strong expression of

endogenous miR-192⁄ 194 (LOVO, HT29, Fig 4A) In

HCT116 cells, which do not express miR-192⁄ 194, no

such difference between wild-type and mutant 3¢UTRs

was observed This result indicates that miR-192⁄ 194

expression is a prominent determinant for Per 3¢UTR

regulation in these cells To explore this further, we

transfected anti-miR RNA oligos targeting

miR-192⁄ 194 or a control miRNA, miRNA-372 Whereas

the transfection of anti-miR-192⁄ 194 completely

abol-ished the miR-192⁄ 194-dependent regulation of Per1

3¢UTR in HT29 cells, transfection of the control anti-miR left it intact (Fig 4B) Together, these results show that endogenously expressed miR-192⁄ 194 also suppresses the synthesis of Per proteins

miR-192⁄ 194 overexpression alters the circadian rhythm

Deregulation of Per genes in mice has been shown to reduce the length of the circadian period As the downregulation of all three Per genes by miR-192⁄ 194 could potentially have a similar effect on period length, we overexpressed the miR-192⁄ 194 cluster in NIH3T3 cells to identify its effect on the circadian cycle In NIH3T3 cells, miR-192 and miR-194 are almost undetectable (Fig 5A) As expected, the intro-duction of miR-Vec-192⁄ 194 in these cells resulted in a strong expression level of both miRNAs (Fig 5A) This level of expression, however, was comparable with endogenous miR-192⁄ 194 observed in human colorectal cell lines (Fig 5B)

Fig 1 Identification of miR192 ⁄ 194

regula-tory capacities towards the Per gene family

using a forward genetic screen (A–C)

Representative M–A plots of the Per1, Per2

and Per3 screens, respectively Each graph

shows the relative abundance of each

indi-vidual miRNA insert in the low and total

GFP populations The top outlier

(miR-Vec-192–194 cluster) is encircled (D–F) Tables

showing the top five miRNA outliers, which

are more abundant in the low-GFP

popula-tion from a duplicate screen on the Per1,

Per2 and Per3 3¢UTRs, respectively.

Subsequently, we made use of the engineered NIH3T3 cells expressing miR-192⁄ 194 to determine the effects on the circadian cycle by monitoring BMAL1 mRNA levels As described previously, levels

of BMAL1 mRNA oscillate in a circadian fashion in time following serum shock Examination of BMAL1 mRNA oscillation over a time course of 64 h revealed

A

B

C

D

*

*

*

Fig 2 Validation of the effect of miR-192 ⁄ 4 on the Per 3¢UTRs.

(A–C) Verification of the effect of miR-192 ⁄ 194 on GFP expression in

HeLa-GFP-UTR constructs of Per1, Per2 and Per3 3¢UTRs,

res-pectively Graphs depicting the GFP expression of the control and

miR-Vec-192 ⁄ 4 are shown in different colours (D) Luciferase assay

showing the effect of miR-192 ⁄ 194 expression on luciferase

con-structs coupled to the Per 3¢UTRs Values represent a triplicate

assay, in which the data are represented as the standardized

mean ± standard error of the mean (SEM) *Significant difference

when compared with the control (P < 0.01), as determined by a

two-tailed t-test All experiments are representative of a triplicate repeat.

*

*

*

A

B

C

D

Fig 3 Mutational analysis of Per 3¢UTRs shows direct regulation

by miR-192 ⁄ 194 (A) Schematic representation of the 3¢UTR of the Per genes The different target sites for miR-192 ⁄ 194 are indicated (B–D) Dual luciferase assay showing the effect of miR-192 ⁄ 194 on the 3¢UTRs of Per1, 2 and 3, respectively, in both the wild-type and mutated form Values represent a triplicate assay, in which the data are represented as the standardized mean ± standard error of the mean (SEM) *Significant difference when compared with the control (P < 0.01), as determined by a two-tailed t-test.

a reproducible alteration of the circadian rhythm in

cells expressing miR-192⁄ 194 compared with control

cells (Figs 5C, S2, see Supporting information) These

data suggest that the expression of miR-192⁄ 194

short-ens the length of the circadian period in a cellular

system through the simultaneous inhibition of all

Pergenes

Discussion

Using a target-based screening technique, we have

uncovered a new method of regulation of core

compo-nents of the circadian clock We identified the

miR-192⁄ 194 cluster as a potent regulator of the entire Per

gene family, which consists of Per1, Per2 and Per3

This finding depicts a direct regulation of core

compo-nents of the circadian clock Strikingly, exogenous overexpression of miR-192⁄ 194 leads to an altered circadian cycle

miRNAs and the circadian clock Since the discovery of the molecular mechanism regu-lating circadian rhythms, it has been recognized that tight transcriptional control is essential for correct cir-cadian cycling [17] Recently, post-transcriptional events have also been implicated in the control of the circadian clock [8–11] Not surprisingly, miRNAs have also been shown to possess regulatory capacities on the circadian rhythm [12] It has been suggested that miR-219 and miR-132 are capable of shortening the circadian period and negatively regulating the light-dependent resetting of the clock, respectively [12] However, amongst the target genes suggested for these two miRNAs, which are regulated in a circadian fash-ion, no core components of the circadian clock were found This suggests that these miRNAs affect the cir-cadian clock via indirect mechanisms The identifica-tion of the miR-192⁄ 194 cluster as a potent regulator

of the Per gene family, however, shows that the core clock proteins are also under post-transcriptional control exerted by miRNAs

miRNAs and the circadian cycle miR-219 is capable of shortening the circadian period

by 10–20 min [12] The exact mechanism by which this miRNA is able to alter the circadian period, however, still remains to be examined In addition to this, the data presented here show that miR-192⁄ 194 expression also affects the circadian cycle, potentially through the downregulation of the entire Per gene family Additional quantitative experiments on the observed alteration of the circadian rhythm need to show whether this effect is caused by a shortening

of the circadian period length or by a phase shift phenotype

At present, we cannot exclude the possibility that miR-192⁄ 194 has additional targets other than the Per genes that assist in the regulation of the circadian clock However, the alteration of the circadian rhythm seems to be in good agreement with the effects of knockout studies of the individual Per family members

in mice Knockout of Per1, Per2 and Per3 in mice leads to a shortening in circadian period of about 1, 1.5 and 0.5 h, respectively [18–20] Our results suggest that partial inhibition of all Per genes by miR-192⁄ 194 may achieve a similar effect on the circadian clock as the complete loss of individual Per genes

P < 0.01

A

B

Fig 4 The effect of endogenously expressed miR-192 ⁄ 194 on Per

genes (A) Luciferase assay showing the relative expression of

luciferase genes coupled to the Per 3¢UTRs in different cell lines.

Values represent a triplicate assay, in which the data are

repre-sented as the standardized mean ± standard error of the mean

(SEM) HCT116 cells express low levels of miR-192 ⁄ 194, whereas

LOVO and HT29 cells express high levels of this miRNA cluster.

(B) Dual luciferase assay showing the effect of inhibition of

miR-192⁄ 194 in cells endogenously expressing this miRNA cluster

(HT29) in comparison with control cells Values represent a

tripli-cate assay, in which the data are represented as the standardized

mean ± SEM.

Regulation of the miR-192⁄ 194 cluster

It has been reported that miRNA-192 and miR-194

can be induced by several factors, such as hepatocyte

nuclear factor-1a and p53 [21–23] This suggests that

different cellular processes might affect the circadian

clock, for example genotoxic stresses that activate p53

It has been proposed that the expression of most

CCGs peaks just before dawn and appears to prepare

for the stress caused by daily sun exposure [24]

Specu-lating on this, the induction of miR-192⁄ 194 by

acti-vated p53 might be a means for cells to adjust the

circadian time to the level of radiation they encounter

The observation that miR-192 and miR-194 are both

highly expressed in liver and kidney implies that these

miRNAs play a role in both of these tissues [25,26]

Interestingly, both of these tissues have been suggested

to be the only ones that are able to maintain circadian

rhythms of clock gene expression in the absence of a

functional SCN [27] Therefore, it would be interesting

to determine the exact role of miR-192⁄ 194 in these tissues Together, the identification of inhibitory miRNAs for the Per genes adds more complexity to the mode of regulation of core components of the circadian clock and the clock itself

Experimental procedures

Cell culture

HCT116, HCT15, HT29, LOVO, LS174T, SW48, SW480, WiDr and EcoPack cells were cultured in Dulbecco’s modi-fied Eagle’s medium supplemented with 10% fetal bovine serum and antibiotics The serum shock to induce circadian cycling of NIH3T3 cells was carried out as described

cells were plated

in a six-well plate, which was left for 3 days in normal med-ium Subsequently, the medium was replaced with medium containing 1% serum for 2 days At time 0, the medium

C

Fig 5 The effect of altered miR-192 ⁄ 194 expression on the circadian cycle (A) Relative expression of miR-192 ⁄ 194 in NIH3T3 cells stably transduced with miR-Vec-192 ⁄ 4, as determined by quantitative PCR (B) Comparison of the miRNA levels in a set of colorectal cell lines and NIH3T3 cells overexpressing miR-192 ⁄ 194 NIH3T3) is the control cell line and NIH3T3+ indicates the cells overexpressing miR-192 ⁄ 194 (C) Graph showing the periodicity of Bmal1 mRNA levels in NIH3T3 cells with high levels of miR-192 ⁄ 194 and control cells, as determined

by quantitative PCR All data here represent triplicate PCRs, in which the data are represented as the standardized mean The graph shown

is a representative experiment from a duplicate repeat.

was exchanged for medium containing 50% horse serum.

After 2 h, this medium was replaced with serum-free

medium and the cells were harvested at the indicated time

points

Constructs

GFP-Per1-3¢UTR, GFP-Per2-3¢UTR and GFP-Per3-3¢UTR

were constructed by cloning the 3¢UTR of the respective

the GFP sensor vector, as described in [13] The 3¢UTRs of

Per1, 2 and 3 were amplified from genomic DNA using the

following primers: Per1 forw, GAATTCTTAAACTCC

ATTCTGGGACCATCTCC; Per1 rev, AGATCTGGCGT

TTTTATCTTTTTGTATT; Per2 forw, GAATTCTTAAC

AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GGA

TCCGGCAAACAGGTCATAAAAAGACAC; Per3 forw,

GAATTCTTAAGTGACTGTGAGGATGAACCTTC; Per3

rev, GGATCCTCACGTTTTACATGTACAGAGTTTA

Luc-Per1-3¢UTR, Luc-Per2-3¢UTR and Luc-Per3-3¢UTR

were produced by subcloning of the 3¢UTR of Per into the

pGL3 vector (Promega) downstream of the luciferase gene

by means of PCR The primers used for this PCR were as

TGGGACCATCTCC; Per1 rev, GCACCGGTGGCGTTT

TTATCTTTTTGTATT; Per2 forw, GCGACGTCTTAAC

AGCCAGCGAGGTACACCAGGTGG; Per2 rev, GCAC

CGGTGGCAAACAGGTCATAAAAAGACAC; Per3

CTTC; Per3 rev, GCACCGGTTCACGTTTTACATGTA

CAGAGTTTA Mutants of the Per 3¢UTR luciferase

reporters were constructed using the QuickChange Multi

Site-Directed Mutagenesis Kit (Stratagene), according to

the manufacturer’s protocol Luc-Per1-3¢UTR-Mut was

cre-ated using the following primer: GGCGTTTTTATCT

TTTTGTATTAAAAAAGTAGGGATCCACACAAATAT

Luc-Per2-3¢UTR-Mut were established using the following primers:

GGTAGCAGTCTGCATTCTTATGGCCATTAGAAAAA

CAAAACTCCTTGCCTCTAAAGTCAGATCATGAA and

GCCTCTGCCAGTGTCCCCAGCACTTTTCAAAACTTT

Luc-Per3-3¢UTR-Mut contains three mutated target sites which were

gener-ated using the following primers: GGATGAACCTTCA

TACCCTTTCCAAGACGAAAACAACAGACAGACCTT

TTTAAGTCCTGGACTT, GAGCCCCAAACCTTAGCCT

CATTTATTTTGTTCAAAACAATAAGTCATTTTCCCC

TTAGAGTGCTTGAAGAA and CATGAATGTTACCC

AAAAAGCTGTGTTTTCTTTGGTCAGCAAAACAAAT

TTATGAAAAACAAAATGCTGTATGAATGGAAATCA

Luciferase assay

Luciferase assays were performed using HeLa cells, which

were transfected using Fugene (Roche) For

Luc-Per-3¢UTR reporter assays, cells were cultured in 24-well plates and transfected with 5 ng of Luc-Per-3¢UTR (or mutant constructs), 5 ng of Renilla and 0.5 lg of

The colorectal cell lines were transfected in the same manner as described for HeLa cells, except that Lipofecta-min2000 (Invitrogen) was used as transfection reagent The anti-miRs were transfected in an amount of 0.5 lg for a 24-well plate The anti-miR sequences used were as follows:

Chl-GACAGUCCACAUGGAGUUGCUGUUACACUUGA For these experiments, 10–20 ng of Luc-Per-3¢UTR (or mutant constructs) and 2.5 ng of Renilla were used

Flow cytometry

The separation of low-GFP-expressing miR-Lib-containing cells was performed by cell sorting using the FACSAria cell sorter from Becton Dickinson The validation of miRNA hits was performed as described previously, using HeLa cells stably expressing GFP-Per-3¢UTR [13]

Quantitative RT-PCR and real-time TaqMan PCR

Total RNA was extracted from cell lines using TRIzol reagent, according to the manufacturer’s protocol The syn-thesis of cDNA with Superscript III reverse transcriptase (Invitrogen) was primed with random hexamers The

TTACAGCGGCCATGGCAAGTCACTAAAG) and glyc-eraldehyde-3-phosphate dehydrogenase (GAPDH) (Fwd, CATCCACTGGTGCTGCCAAGGCTGT; Rev, ACAACC TGGTCCTCAGTGTAGCCCA) were designed to amplify 100–200 bp fragments Analyses were carried out using SYBR Green PCR Master Mix (Applied Biosystems) and the ABI Prism 7000 system (Amersham-Pharmacia) The results were normalized with respect to GAPDH expres-sion The mRNA levels were quantified according to the DDCt method

which include RT primers and TaqMan probes, were used to quantify the expression of mature miRNA-192 (AB: 4373108) and miRNA-194 (AB: 4373106) Gene expression was calculated relative to 18S rRNA (AB: 4333760F)

Acknowledgements

This work was supported by the Dutch Cancer Society (KWF), the European Young Investigator Programme and the Centre of Biomedical Genetics (CBG)

1 Schibler U & Sassone-Corsi P (2002) A web of

circa-dian pacemakers Cell 111, 919–922

2 Gekakis N, Staknis D, Nguyen HB, Davis FC,

Wilsbacher LD, King DP, Takahashi JS & Weitz CJ

(1998) Role of the CLOCK protein in the mammalian

circadian mechanism Science 280, 1564–1569

3 Rutila JE, Suri V, Le M, So WV, Rosbash M & Hall

JC (1998) CYCLE is a second bHLH-PAS clock

pro-tein essential for circadian rhythmicity and transcription

of Drosophila period and timeless Cell 93, 805–814

4 Ripperger JA & Schibler U (2006) Rhythmic

CLOCK-BMAL1 binding to multiple E-box motifs drives

circa-dian Dbp transcription and chromatin transitions Nat

Genet 38, 369–374

5 Darlington TK, Wager-Smith K, Ceriani MF, Staknis

D, Gekakis N, Steeves TD, Weitz CJ, Takahashi JS &

Kay SA (1998) Closing the circadian loop:

CLOCK-induced transcription of its own inhibitors per and tim

Science 280, 1599–1603

6 Zylka MJ, Shearman LP, Weaver DR & Reppert SM

(1998) Three period homologs in mammals: differential

light responses in the suprachiasmatic circadian clock

and oscillating transcripts outside of brain Neuron 20,

1103–1110

7 Preitner N, Damiola F, Lopez-Molina L, Zakany J,

Duboule D, Albrecht U & Schibler U (2002) The

orphan nuclear receptor REV-ERBalpha controls

circadian transcription within the positive limb of the

mammalian circadian oscillator Cell 110, 251–260

8 Toh KL, Jones CR, He Y, Eide EJ, Hinz WA, Virshup

DM, Ptacek LJ & Fu YH (2001) An hPer2

phosphory-lation site mutation in familial advanced sleep phase

syndrome Science 291, 1040–1043

9 Eide EJ, Vielhaber EL, Hinz WA & Virshup DM

(2002) The circadian regulatory proteins BMAL1 and

cryptochromes are substrates of casein kinase Iepsilon

J Biol Chem 277, 17248–17254

10 Siepka SM, Yoo SH, Park J, Song W, Kumar V, Hu

Y, Lee C & Takahashi JS (2007) Circadian mutant

Overtime reveals F-box protein FBXL3 regulation of

cryptochrome and period gene expression Cell 129,

1011–1023

11 Cardone L, Hirayama J, Giordano F, Tamaru T,

Palvimo JJ & Sassone-Corsi P (2005) Circadian clock

control by SUMOylation of BMAL1 Science 309,

1390–1394

12 Cheng HY, Papp JW, Varlamova O, Dziema H, Russell

B, Curfman JP, Nakazawa T, Shimizu K, Okamura H,

Impey S et al (2007) microRNA modulation of

circa-dian-clock period and entrainment Neuron 54, 813–829

13 le Sage C, Nagel R, Egan DA, Schrier M, Mesman E,

Mangiola A, Anile C, Maira G, Mercatelli N, Ciafre

SA et al (2007) Regulation of the p27(Kip1) tumor

suppressor by miR-221 and miR-222 promotes cancer cell proliferation EMBO J 26, 3699–3708

14 Nagel R, le Sage C, Diosdado B, van der Waal M, Oude Vrielink JA, Bolijn A, Meijer GA & Agami R (2008) Regulation of the adenomatous polyposis coli gene by the miR-135 family in colorectal cancer Cancer Res 68, 5795–5802

15 Grimson A, Farh KK, Johnston WK, Garrett-Engele P, Lim LP & Bartel DP (2007) MicroRNA targeting speci-ficity in mammals: determinants beyond seed pairing Mol Cell 27, 91–105

16 Bandres E, Cubedo E, Agirre X, Malumbres R, Zarate

R, Ramirez N, Abajo A, Navarro A, Moreno I, Monzo

M et al (2006) Identification by real-time PCR of 13 mature microRNAs differentially expressed in colorectal cancer and non-tumoral tissues Mol Cancer 5, 29

17 Loros JJ & Dunlap JC (1991) Neurospora crassa clock-controlled genes are regulated at the level of transcrip-tion Mol Cell Biol 11, 558–563

18 Zheng B, Larkin DW, Albrecht U, Sun ZS, Sage M, Eichele G, Lee CC & Bradley A (1999) The mPer2 gene encodes a functional component of the mammalian circadian clock Nature 400, 169–173

19 Zheng B, Albrecht U, Kaasik K, Sage M, Lu W, Vaish-nav S, Li Q, Sun ZS, Eichele G, Bradley A et al (2001) Nonredundant roles of the mPer1 and mPer2 genes in the mammalian circadian clock Cell 105, 683–694

20 Shearman LP, Jin X, Lee C, Reppert SM & Weaver

DR (2000) Targeted disruption of the mPer3 gene: sub-tle effects on circadian clock function Mol Cell Biol 20, 6269–6275

21 Hino K, Tsuchiya K, Fukao T, Kiga K, Okamoto R, Kanai T & Watanabe M (2008) Inducible expression of microRNA-194 is regulated by HNF-1alpha during intestinal epithelial cell differentiation RNA 14, 1433– 1442

22 Braun CJ, Zhang X, Savelyeva I, Wolff S, Moll UM, Schepeler T, Orntoft TF, Andersen CL & Dobbelstein

M (2008) p53-Responsive microRNAs 192 and 215 are capable of inducing cell cycle arrest Cancer Res 68, 10094–10104

23 Georges SA, Biery MC, Kim SY, Schelter JM, Guo J, Chang AN, Jackson AL, Carleton MO, Linsley PS, Cleary MA et al (2008) Coordinated regulation of cell cycle transcripts by p53-inducible microRNAs, miR-192 and miR-215 Cancer Res 68, 10105–10112

24 Correa A, Lewis ZA, Greene AV, March IJ, Gomer

RH & Bell-Pedersen D (2003) Multiple oscillators regu-late circadian gene expression in Neurospora Proc Natl Acad Sci USA 100, 13597–13602

25 Sun Y, Koo S, White N, Peralta E, Esau C, Dean NM

& Perera RJ (2004) Development of a micro-array to detect human and mouse microRNAs and characteriza-tion of expression in human organs Nucleic Acids Res

32, e188

26 Tang X, Gal J, Zhuang X, Wang W, Zhu H & Tang G

(2007) A simple array platform for microRNA analysis

and its application in mouse tissues RNA 13, 1803–1822

27 Guo H, Brewer JM, Champhekar A, Harris RB

& Bittman EL (2005) Differential control of peripheral

circadian rhythms by suprachiasmatic-dependent neural

signals Proc Natl Acad Sci USA 102, 3111–3116

28 Balsalobre A, Damiola F & Schibler U (1998) A serum

shock induces circadian gene expression in mammalian

tissue culture cells Cell 93, 929–937

Supporting information

The following supplementary material is available:

Fig S1 Relative expression levels of miR-192⁄ 194 in

colorectal cell lines

Fig S2 Reproduction of the data shown in Fig 5C, revealing the effect of altered miR-192⁄ 194 expression

on the circadian cycle

This supplementary material can be found in the online article

Please note: As a service to our authors and readers, this journal provides supporting information supplied

by the authors Such materials are peer-reviewed and may be re-organized for online delivery, but are not copy-edited or typeset Technical support issues arising from supporting information (other than missing files) should be addressed to the authors