Genetics from genes to genomes, 2003 (3rd edition) leland hartwell, leroy hood, michael l goldberg, ann e reynolds

Dr. Leland Hartwell is President and Director of Seattle’s Fred Hutchinson Cancer Research Center and Professor of Genome Sciences at the University of Washington. Dr. Hartwell’s primary research contributions were in identifying genes that control cell division in yeast including those necessary for the division process as well as those necessary for the fidelity of genome reproduction. Subsequently many of these same genes have been found to control cell division in humans and often to be the site of alteration in cancer cells. Dr. Hartwell is a member of the National Academy of Sciences and has received the Albert Lasker Basic Medical Research Award, the Gairdner Foundation International Award, the Alfred P. Sloan Award in Cancer Research, and the 2001 Nobel Prize in Physiology or Medicine.Genetics research tends to proceed down highly specialized paths. A number of experts in specific areas generously provided information in their areas of expertise. We thank them for their contributions to this edition of our text

Tools to Help You Master Genetics

Study Guide/Solutions Manual

By Debra Nero, Cornell University

ISBN 978-0-07-299587-9

MHID 0-07-299587-4

Written to support the concepts presented in Genetics: From Genes to Genomes, Third Edition,

this manual includes solutions to the end-of-chapter problems Solutions are given with

step-by-step logic to help strengthen your problem-solving skills.

McGraw-Hill’s ARIS

(Assessment Review and Instruction System)

Makes homework meaningful—and manageable—for

instructors and students.

Explore this dynamic site for a variety of study tools.

• Self-quizzes

• Flash cards

• Animations with quizzing

• Interactive Web Exercises

Go to aris.mhhe.com to learn more or go directly to this book’s ARIS site at

www.mhhe.com/hartwell3

Animations with Quizzing

More than 40 animations are available at www.mhhe.com/hartwell3 These animations set

genetics processes in motion, and make great study and review tools since you control the action.

From Genes to Genomes

Third Edition

Leland H Hartwell Leroy Hood

Michael L Goldberg Ann E Reynolds

Lee M Silver Ruth C Veres

Hartwell Hood Goldberg Reynolds Silver Veres

Third Edition

ISBN 978–0–07–284846–5

MHID 0–07–284846–4

Publisher: Janice Roerig-Blong

Executive Editor: Patrick E Reidy

Developmental Editor: Rose M Koos

Executive Marketing Manager: Chad E Grall

Lead Project Manager: Joyce M Berendes

Senior Production Supervisor: Laura Fuller

Senior Media Project Manager: Jodi K Banowetz

Senior Media Producer: Eric A Weber

Senior Designer: David W Hash

Cover/Interior Designer: Rokusek Design

(USE) Cover Image: DNA, A Pasieka/Photo Researchers, Inc.

Lead Photo Research Coordinator: Carrie K Burger

Photo Research: Jerry Marshall

Supplement Producer: Melissa M Leick

Compositor: Techbooks

Typeface: 10.5/12 Times Roman

Printer: R R Donnelley Willard, OH

The credits section for this book begins on page C-1 and is considered an extension of the

copyright page.

Library of Congress Cataloging-in-Publication Data

Genetics : from genes to genomes / Leland H Hartwell [et al.] — 3rd ed.

p ; cm.

Includes bibliographical references and index.

ISBN 978–0–07–284846–5 — ISBN 0–07–284846–4 (hard copy : alk paper)

1 Genetics I Hartwell, Leland.

[DNLM: 1 Genetics QU 450 G3287 2008]

QH430.G458 2008

576.5—dc22 2006022898

CIP

GENETICS: FROM GENES TO GENOMES, THIRD EDITION

Published by McGraw-Hill, a business unit of The McGraw-Hill Companies, Inc., 1221 Avenue of

the Americas, New York, NY 10020 Copyright © 2008 by The McGraw-Hill Companies, Inc All rights

reserved No part of this publication may be reproduced or distributed in any form or by any

means, or stored in a database or retrieval system, without the prior written consent of The

McGraw-Hill Companies, Inc., including, but not limited to, in any network or other electronic

storage or transmission, or broadcast for distance learning.

Some ancillaries, including electronic and print components, may not be available to customers

outside the United States.

This book is printed on acid-free paper.

1 2 3 4 5 6 7 8 9 0 DOW/DOW 0 9 8 7 6

www.mhhe.com

CONFIRMING PAGES

About the Authors

Dr Leland Hartwellis President andDirector of Seattle’s Fred HutchinsonCancer Research Center and Professor

of Genome Sciences at the University

of Washington

Dr Hartwell’s primary researchcontributions were in identifying genesthat control cell division in yeastincluding those necessary for the divi-sion process as well as those necessary for the fidelity

of genome reproduction Subsequently many of these

same genes have been found to control cell division in

humans and often to be the site of alteration in cancer

cells

Dr Hartwell is a member of the National Academy

of Sciences and has received the Albert Lasker Basic

Medical Research Award, the Gairdner Foundation

International Award, the Alfred P Sloan Award in Cancer

Research, and the 2001 Nobel Prize in Physiology or

Medicine

Dr Lee Hood received an M.D

from the Johns Hopkins MedicalSchool and a Ph.D in biochemistryfrom the California Institute ofTechnology His research interestsinclude immunology, cancer biology,development, and the development ofbiological instrumentation (for exam-ple, the protein sequencer and the auto-mated fluorescent DNA sequencer) His early research

played a key role in unraveling the mysteries of antibody

diversity More recently he has pioneered systems

approaches to biology and medicine

Dr Hood has taught molecular evolution, ogy, molecular biology, genomics and biochemistry and

immunol-has co-authored textbooks in biochemistry, molecular

biol-ogy, and immunolbiol-ogy, as well as The Code of Codes—a

monograph about the Human Genome Project He was one

of the first advocates for the Human Genome Project and

directed one of the federal genome centers that sequenced

the human genome Dr Hood is currently the president

(and co-founder) of the cross-disciplinary Institute for

Systems Biology in Seattle, Washington

Dr Hood has received a variety of awards, includingthe Albert Lasker Award for Medical Research (1987),the Distinguished Service Award from the NationalAssociation of Teachers (1998) and the Lemelson/MITAward for Invention (2003) He is the 2002 recipient ofthe Kyoto Prize in Advanced Biotechnology—an awardrecognizing his pioneering work in developing the pro-tein and DNA synthesizers and sequencers that providethe technical foundation of modern biology He is deeplyinvolved in K-12 science education His hobbies includerunning, mountain climbing, and reading

Dr Michael Goldbergis a professor

at Cornell University, where he teachesintroductory genetics He was an under-graduate at Yale University and receivedhis Ph.D in biochemistry from StanfordUniversity Dr Goldberg performedpostdoctoral research at the Biozentrum

of the University of Basel (Switzerland)and at Harvard University, and hereceived an NIH Fogarty Senior International Fellowshipfor study at Imperial College (England) and at theUniversity of Rome (Italy) His current research uses the

tools of Drosophila genetics to investigate the mechanisms

that ensure proper chromosome segregation during mitosisand meiosis

Dr Ann Reynoldsis an educator andauthor She began teaching genetics andbiology in 1990, and her research has

included studies of gene regulation in E.

coli, chromosome structure and DNA

replication in yeast, and chloroplast geneexpression in marine algae She is a grad-uate of Mount Holyoke College andreceived her Ph.D from Tufts University

Dr Reynolds was a postdoctoral fellow in the HarvardUniversity Department of Molecular Biology and GenomeSciences at the University of Washington She was also anauthor and producer of the laserdisc and CD-ROM

Genetics: Fundamentals to Frontiers.

CONFIRMING PAGES

iv About the Authors

Dr Lee M Silver received B.A andM.S degrees in physics from theUniversity of Pennsylvania, and a Ph.D

in biophysics from Harvard University

He obtained further training at NewYork’s Memorial Sloan-Kettering CancerCenter, Cold Spring Harbor Laboratory,and the Pasteur Institute in Paris, France

Since 1984, he has been a professor atPrinceton University, currently in the Department of

Molecular Biology and the Woodrow Wilson School of

Public and International Affairs He also has joint

appoint-ments in the Program in Science, Technology, and

Environmental Policy, the Center for Health and Wellbeing,

the Office of Population Research, and the Princeton

Environmental Institute, all at Princeton University

Dr Silver has published over 200 articles in the fields

of mammalian genetics, evolution, reproduction,

embryol-ogy, computer modeling, and behavioral science, and

other scholarly papers on topics at the interfaces among

biotechnology, law, politics, and religion He has been

elected to the governing boards of the Genetics Society of

America and the International Mammalian Genome

Society, and was a member of the New Jersey Bioethics

Commission Task Force formed to recommend

reproduc-tive policy for the New Jersey State Legislature Silver has

been elected a lifetime fellow of the American Association

for the Advancement of Science (AAAS) and he received

a prestigious MERIT Award for outstanding research ingenetics from the National Institutes of Health

Dr Silver’s other books include Remaking Eden:

How Genetic Engineering and Cloning will Transform the American Family, published in 16 languages, Mouse Genetics, and Challenging Nature: The Clash of Science and Spirituality at the New Frontiers of Life He has

also written popular articles for The New York Times,

Washington Post, Time Magazine, and Newsweek national Further information about Dr Silver is avail-

Inter-able at www.leemsilver.net

Ruth C Veresis a science writer andeditor with 35 years of experience intextbook publishing She received herB.A from Swarthmore College,obtained M.A degrees from ColumbiaUniversity and Tufts University, andtaught writing and languages at theUniversity of California at Berkeley

In addition to developing and ing more than 30 texts in the fields of political science,economics, psychology, nutrition, chemistry, and biolo-

edit-gy, Veres has coauthored a book on the immune systemand an introductory biology text She is currently work-ing on a book with Dr Lee Hood that looks at biologicalinformation and the emergence of systems biology

Contributors

Genetics research tends to proceed down highly specialized

paths A number of experts in specific areas generously

pro-vided information in their areas of expertise We thank them

for their contributions to this edition of our text

Ian Duncan, Washington University, St Louis

Sylvia Fromherz, University of Colorado at Boulder

Gail E Gasparich, Towson University Bernadette Holdener, State University of New York, Stony Brook Nancy M Hollingsworth, State University of New York,

Chromosomal Rearrangements and Changes

in Chromosome Number Reshape EukaryoticGenomes 489

Chapter 15

The Prokaryotic Chromosome: Genetic

Analysis in Bacteria 539

The Chromosomes of Organelles Outside the

Nucleus Exhibit Non-Mendelian Patterns of

1.3 Complex Systems Arise from DNA-Proteinand Protein-Protein Interactions 4

1.4 All Living Things Are Closely Related at theMolecular Level 5

1.5 The Modular Construction of Genomes Has Allowed the Rapid Evolution ofComplexity 7

1.6 Genetic Techniques Permit the Dissection

of Complexity 81.7 Our Focus Is on Human Genetics 10

Fast Forward 22Tools of Genetics 28Genetics and Society 34

Chapter 3

Extensions to Mendel: Complexities inRelating Genotype to Phenotype 453.1 Extensions to Mendel for Single-GeneInheritance 46

3.2 Extensions to Mendel for MultifactorialInheritance 56

Fast Forward 57Genetics and Society 68

Chapter 4

The Chromosome Theory of Inheritance 814.1 Chromosomes Contain the Genetic

Material 824.2 Mitosis Ensures That Every Cell in anOrganism Carries the Same

Chromosomes 884.3 Meiosis Produces Haploid Germ Cells, theGametes 93

4.4 Gametogenesis Requires Both Mitotic andMeiotic Divisions 103

4.5 Validation of the Chromosome Theory 105

Genetics and Society 87Fast Forward 95

Tools of Genetics 128Fast Forward 142Genetics and Society 154

PART II

What Genes Are and What They Do 167

Chapter 6

DNA: How the Molecule of Heredity

Carries, Replicates, and Recombines

Information 167

6.1 Experiments Designate DNA as the Genetic

Material 1686.2 The Watson-Crick Model: DNA Is a Double

Helix 1736.3 DNA Stores Information in the Sequence of

Its Bases 1806.4 DNA Replication: Copying Genetic

Information for Transmission to the NextGeneration 184

6.5 Recombination Reshuffles the Information

Structure 2247.3 What Mutations Tell Us About Gene

Function 2327.4 How Gene Mutations Affect Light-Receiving

Proteins and Vision: A ComprehensiveExample 239

Genetics and Society 216

Fast Forward 240

Chapter 8

Gene Expression: The Flow of Genetic

Information from DNA to RNA to

Protein 255

8.1 The Genetic Code: How Precise Groupings

of the Four Nucleotides Specify 20 AminoAcids 257

8.2 Transcription: RNA Polymerase Synthesizes

a Single-Stranded RNA Copy of a Gene 265

8.3 Translation: Base Pairing Between mRNAand tRNAs Directs Assembly of a

Polypeptide on the Ribosome 2758.4 There Are Significant Differences in GeneExpression Between Prokaryotes andEukaryotes 282

8.5 Comprehensive Example: A ComputerizedAnalysis of Gene Expression in

C elegans 2848.6 How Mutations Affect Gene Expression andGene Function 285

Genetics and Society 270

9.4 The Polymerase Chain Reaction Provides

a Rapid Method for Isolating DNAFragments 327

9.5 DNA Sequence Analysis 3309.6 Understanding the Genes for Hemoglobin:

A Comprehensive Example 335

Tools of Genetics 306Genetics and Society 320

Chapter 10

Reconstructing the Genome ThroughGenetic and Molecular Analysis 35110.1 Analyses of Genomes 354

10.2 Major Insights from the Human and ModelOrganism Genome Sequences 36610.3 High-Throughput Genomic Platforms Permitthe Global Analysis of Genes and Their

Genetics and Society 381

viii Contents

CONFIRMING PAGES

Chapter 11

The Direct Detection of GenotypeDistinguishes Individual Genomes 39111.1 DNA Variation Is Multifaceted andWidespread 394

11.2 Detecting DNA Genotypes of DifferentTypes of Polymorphisms 399

11.3 Positional Cloning: From DNA Markers toGene Clones 408

11.4 Genetic Dissection of Complex Traits 41911.5 Haplotype Association Studies for High-Resolution Mapping in Humans 423

Genetics and Society 394Tools of Genetics 416

Chapter 12

Systems Biology and Proteomics 43712.1 What Is Systems Biology? 43912.2 Looking at Biology as an InformationalScience Is Central to the Practice of SystemsBiology 440

12.3 Global Proteomics Strategies and Throughput Platforms Make It Possible toGather and Analyze Systemwide ProteinData 444

High-12.4 Putting It All Together: The Practice ofSystems Biology 451

12.5 A Systems Approach to Disease Leads toPredictive, Preventive, and PersonalizedMedicine 455

Genetics and Society 457

Chromosomes: DNA, Histones, andNonhistone Proteins 466

13.2 Chromosome Structure: Variable Protein Interactions Create Reversible Levels

DNA-of Compaction 469

13.3 Specialized Chromosomal Elements EnsureAccurate Replication and Segregation ofChromosomes 474

13.4 How Chromosomal Packaging InfluencesGene Activity 479

Chapter 14

Chromosomal Rearrangements and Changes

in Chromosome Number Reshape EukaryoticGenomes 489

14.1 Rearrangements of DNA Sequences WithinChromosomes 491

14.2 Changes in Chromosome Number 51614.3 A Glimpse of the Future: EmergentTechnologies in the Analysis ofChromosomal Rearrangements and Changes

Genetics and Society 544

Chapter 16

The Chromosomes of Organelles Outside theNucleus Exhibit Non-Mendelian Patterns ofInheritance 581

16.1 The Structure and Function of Mitochondrialand Chloroplast Genomes 583

16.2 Genetic Studies of Organelle GenomesClarify Key Elements of Non-MendelianInheritance 592

16.3 Comprehensive Example: How Mutations inmtDNA Affect Human Health 599

Fast Forward 594Genetics and Society 600

CONFIRMING PAGES

PART V

How Genes Are Regulated 609

Chapter 17

Gene Regulation in Prokaryotes 609

17.1 An Overview of Prokaryotic Gene

Regulation 61117.2 The Regulation of Gene Transcription 612

17.3 The Attenuation of Gene Expression:

Fine-Tuning the trp Operon Through the

Termination of Transcription 62617.4 Global Regulatory Mechanisms Coordinate

the Expression of Many Sets of Genes 62817.5 A Comprehensive Example: The Regulation

of Virulence Genes in V cholerae 632

Genetics and Society 630

Chapter 18

Gene Regulation in Eukaryotes 643

18.1 The Use of Genetics to Study Gene

Regulation 64518.2 Gene Regulation Begins with Control Over

the Initiation of Transcription 64618.3 Regulation After Transcription Influences

RNA Production, Protein Synthesis, andProtein Stability 664

18.4 Sex Determination in Drosophila: A

Comprehensive Example of Gene Regulation 669

Tools of Genetics 670

Chapter 19

Cell-Cycle Regulation and the Genetics

of Cancer 685

19.1 The Normal Control of Cell Division 686

19.2 Cancer Arises When Controls Over Cell

Division No Longer FunctionProperly 696

Genetics and Society 708

Chapter 20

Using Genetics to Study Development 717

20.1 Model Organisms: Prototypes for

Genetics and Society 724

PART VI

How Genes Change 757

21.3 Analyzing the Quantitative Variation ofMultifactorial Traits 773

Genetics and Society 780

Chapter 22

Evolution at the Molecular Level 79122.1 The Origin of Life on Earth 79422.2 The Evolution of Genomes 79922.3 The Organization of Genomes 80522.4 The Immunoglobulin Gene Superfamily: AComprehensive Example of MolecularEvolution 813

Genetics and Society 802

Guidelines for Gene Nomenclature A-1 Brief Answer Section B-1

Glossary G-1 Credits C-1 Index I-1

A Note from the Authors

The science of genetics is less than 150 years old, but its

accomplishments within that short time have been

astonish-ing Gregor Mendel first described genes as abstract units of

inheritance in 1865; his work was ignored and then

“redis-covered” in 1900 Thomas Hunt Morgan and his students

provided experimental verification of the idea that genes

reside within chromosomes during the years 1910-1920 By

1944, Oswald Avery and his coworkers had established that

genes are made of DNA James Watson and Francis Crick

published their pathbreaking structure of DNA in 1953

Remarkably, less than 50 years later (in 2001), an

interna-tional consortium of investigators deciphered the sequence of

the 3 billion nucleotides in the human genome

Twentieth-century genetics made it possible to identify individual genes

and to understand a great deal about their functions

Today, scientists are able to access the enormousamounts of genetic data generated by the sequencing of

many organisms’ genomes Analysis of these data will result

in a deeper understanding of the complex molecular

interac-tions within and among vast networks of genes, proteins,

and other molecules that help bring organisms to life

Finding new methods and tools for analyzing these data will

be a significant part of genetics in the twenty-first century

Our third edition of Genetics: From Genes to Genomes

emphasizes both the core concepts of genetics and the

cutting-edge discoveries, modern tools, and analytic

meth-ods that will keep the science of genetics moving forward

Our Focus—An Integrated Approach

Genetics: From Genes to Genomes represents a new

approach to an undergraduate course in genetics It reflects

the way we, the authors, currently view the molecular basis

of life We integrate:

• Formal genetics: the rules by which genes are

trans-mitted

• Molecular genetics: the structure of DNA and how it

directs the structure of proteins

• Genomics and systems biology: the new

technolo-gies that allow a comprehensive analysis of the entiregene set and its expression in an organism

Preface

• Human genetics: how genes contribute to health and

disease

• The unity of life-forms: the synthesis of information

from many different organisms into coherent modelsthat explain many biological systems

• Molecular evolution: the molecular mechanisms by

which biological systems and whole organisms haveevolved and diverged

The strength of this integrated approach is that studentswho complete the book will have a strong command of genet-ics as it is practiced today by academic and corporateresearchers These scientists are rapidly changing our under-standing of living organisms, including ourselves; increasingour ability to prevent, diagnose, and treat disease and to engi-neer new life-forms for food and medical uses; and, ultimate-

ly, creating the ability to replace or correct detrimental genes

The Genetic Way of Thinking

To encourage a genetic way of thinking, we begin the bookwith a presentation of Mendelian principles and the chromo-somal basis of inheritance From the outset, however, the inte-gration of Mendelian genetics with fundamental molecularmechanisms is central to our approach Chapter 1 presents thefoundation of this integration In Chapter 2, we tie Mendel’sstudies of pea-shape inheritance to the action of an enzymethat determines whether a pea is round or wrinkled In thesame chapter, we point to the relatedness of patterns of hered-ity in all organisms by using Mendelian principles to look

at heredity in humans Starting in Chapter 6, we focus onthe physical characteristics of DNA, the implica-tions and uses of mutations, and how the doublehelix structure of DNA encodes, copies, and trans-mits biological information Beginning in Chapter 9 we look

at modern genetic techniques, including such biotechnologytools as gene cloning, hybridization, PCR, and microarrays,exploring how researchers use them to reveal the modularconstruction and genetic relatedness of genomes We thenshow how the complete genome sequences of humans andmodel organisms provide insights into the architecture andevolution of genomes; how modular genomic constructionhas contributed to the relatively rapid evolution of life andhelped generate the enormous diversity of life-forms we seearound us

CONFIRMING PAGES

Genetic portrait chapters on the website (www.mhhe.

organ-isms, which clarify that their use in the study of human

biol-ogy is possible only because of the genetic relatedness of all

organisms Throughout our book, we present the scientific

reasoning of some of the ingenious researchers who have

car-ried out genetic analysis, from Mendel, to Watson and Crick,

to the collaborators on the Human Genome Project

Student-Friendly Features

We have taken great pains to help the student make the leap

to a deeper understanding of genetics Numerous features

of this book were developed with that goal in mind

• One Voice The role of our science writer, Ruth Veres,

is to create one voice for our author team With more

than 30 years’ experience in life science textbook

pub-lishing, Ms Veres is uniquely suited to this task By

working closely with everyone on the team, she has

created the friendly, engaging reading style that helps

students master the concepts throughout this book

This team approach provides the student with the focus

and continuity required to make the book successful in

the classroom

• Visualizing Genetics The highly specialized art

pro-gram developed for this book integrates photos and

line art in a manner that provides the most engaging

visual presentation of genetics available Our Feature

Figure illustrations break down complex processes

into step-by-step illustrations that lead to greater

stu-dent understanding All illustrations are rendered with

a consistent color theme—for example, all

presenta-tions of phosphate groups are the same color, as are all

presentations of mRNA

• Problem Solving Developing strong problem-solving

skills is vital for every genetics student The authors

have carefully created problem sets at the end of each

chapter that allow students to improve upon their

problem-solving ability

• Social and Ethical Issues questions require critical

thinking analysis of the scientific issues that impact

our society

• Solved Problems provide insight into the

step-by-step process of problem solving

• Review Problems offer a variety of levels of

ques-tions that develop excellent problem-solving skills

• Accessibility Our intention is to bring cutting-edge

content to the student level A number of more

com-plex illustrations are revised and segmented to help the

student follow the process Legends have been

stream-lined to highlight only the most important ideas, and

throughout the book, topics have been revised to focus

on the most critical information

New to the Third Edition

• The End-of-Chapter Problem Sets Have Been

Extensively Revised and include over 100 new

prob-lems The problems are now organized by chapter tion and in order of increasing difficulty within eachsection for ease of use by instructors and students.Each chapter contains a variety of problem types

sec-including: Social & Ethical Issues which prompt the

student to apply problem-solving skills to real-worldsituations that scientific breakthroughs have forced us

to face as a society; Solved Problems which cover

top-ical material with complete answers to aid the student

in understanding the problem solving process; and

Problems & Questions that allow students to develop

their own problem-solving skills Answers to selectedproblems are in the back of the book

• New Chapter: Chapter 12 Systems Biology and Proteomics provides a framework for thinking about

what a biological system is and describes tools foranalyzing the genes and proteins of a system, as well ascomputational tools for integrating and modeling thisinformation to begin to explain a system’s emergentproperties

• Content Updates throughout make this the most

cur-rent and modern book available Every chapter reflectsthe updated information generated by the break-throughs of the past few years For example,

• Chapter 18, Gene Regulation in Eukaryotes,

dis-cusses the latest on RNAi technology

• Chapter 22, Evolution at the Molecular Level,

includes information on network evolution andcomparative genome evolution

• “Tools of Genetics” boxed essays are new to this

edi-tion They explain various techniques geneticists use

to look at DNA, genes, other aspects of the genome,and proteins, with examples of interesting applications

in biology and medicine

• An “On Our Website” Feature, located at the end of

each chapter, directs students and teachers to additional,more detailed information on specialized topics notfound in the textbook This information is in the form

of new content, references, or links to other websites

• Interactive Web Exercises offer students an

interac-tive way to analyze genetic data on the Web and plete exercises that test their understanding of the data

com-• A New Design is more user friendly and emphasizes the

pedagogical structure and features of the presentation

CONFIRMING PAGES

A Word About the Portraits of Model

Organisms

Five Genetic Portraits are included on the book-specific

PDF files The Genetic Portraits are also available as a

printed supplement upon request Each Genetic Portrait

profiles a different model organism whose study has

con-tributed to genetic research The five selected were the

ones chosen as the focus of the Human Genome Project

They are:

Saccharomyces cerevisiae: Genetic Portrait of Yeast Arabidopsis thaliana: Genetic Portrait of a Model Plant Caenorhabditis elegans: Genetic Portrait of a Simple

Multicellular Organism

Drosophila melanogaster: Genetic Portrait of the

Fruit Fly

Mus musculus: Genetic Portrait of the House Mouse

We anticipate that instructors will choose to cover one or

two portraits during the semester Students may then use

the specifics of the selected model organism to build anunderstanding of the principles and applications discussed

in the book The unique genetic manipulations and ties of each of the models make them important for address-ing different biological questions using genetic analysis Inthe portraits, we explain how biologists learned that theevolutionary relatedness of all organisms permits theextrapolation from a model to the analysis of other livingforms The portraits should thus help students understandhow insights from one model organism can suggest gener-

proper-al principles applicable to other organisms, includinghumans

Guided Tour

Students and instructors can become acquainted with thekey features of this book by browsing through the GuidedTour starting on the next page These pages constitute avisual exposition of the book’s pedagogy and art program

CONFIRMING PAGES

Integrating Genetic Concepts

Genetics: From Genes to Genomes takes an integrated approach in its presentation of genetics, thereby givingstudents a strong command of genetics as it is practiced today by academic and corporate researchers.Principles are related throughout the text in examples, essays, case histories, and Connections sections

to make sure students fully understand the relationships between topics

Guided Tour

Genes determine traits as disparate as pea shape and the herited human disease of cystic fibrosis by encoding the and function As early as 1940, investigators had uncovered mation of enzymes, proteins that catalyze specific chemical published his analysis of seven pairs of observable traits in for pea shape and pinpointed how it prescribes a seed’s mines About the same time, medical researchers in the ered how a mutant allele causes unusually sticky mucous

in-Genes Encode Proteins

Figure ARound and wrinkled peas: How one gene determines an enzyme that affects pea shape The R allele of the pea shape

gene directs the synthesis of an enzyme that converts unbranched starch to branched starch, indirectly leading to round pea shape.

The r allele of this gene determines an inactive form of the enzyme, leading to a buildup of linear, unbranched starch that ultimately

causes seed wrinkling The photograph at right shows two pea pods, each of which contains wrinkled (arrows) and round peas; the ratio of round to wrinkled in these two well-chosen pods is 9:3 (or 3:1).

X

Biochemical Change of Unbranched Starch Molecules

Dominant allele R

Recessive allele r

Unbranched starch

Unbranched starch Unbranched starch

Branched starch

No conversion Conversion

Active enzyme

Round pea

Wrinkled pea

Inactive enzyme

Pea Shape Gene

digestive malfunction, once again, through the protein the gene determines.

The pea shape gene encodes an enzyme known as SBE1 (for starch-branching enzyme 1), which catalyzes the con- starch, to amylopectin, a starch molecule composed of sev- pea shape gene causes the formation of active SBE1 enzyme duce a high proportion of branched starch molecules, which allow the peas to maintain a rounded shape In contrast, and does not function effectively In homozygous recessive

rrpeas, where there is less starch conversion and more of the linear, unbranched starch, sucrose builds up The excess

Tools of Genetics Essays

Current readings explain various techniques

and tools used by geneticists, including

examples of applications in biology and

medicine

Genetics and Society Essays

Dramatic essays explore the social and

ethical issues created by the multiple

applications of modern genetic research

Serendipity in Science: The Discovery

of Restriction Enzymes

Most of the tools and techniques for cloning and analyzing viruses that infect them Molecular biologists had observed, strain of bacteria grew poorly on a closely related strain of discrepancy, they discovered restriction enzymes.

To follow the story, one must know that researchers

compare rates of viral proliferation in terms of plating

effi-ciency:the fraction of viral particles that enter and replicate inside host bacterial cells, causing the cells to lyse and release side neighboring cells, which lyse and release further virus coated with a continuous “lawn” of bacterial cells, an active plaque, where bacteria have been eliminated (see Fig 7.2 0

on p 228) The plating efficiency of lambda virus grown on E.

coliC is nearly 1.0 This means that 100 original virus particles

will cause close to 100 plaques on a lawn of E coli C bacteria.

The plating efficiency of the same virus grown on E coli

K12 is only 1 in , or 0.0001 The ability of a bacterial strain

to prevent the replication of an infecting virus, in this case

the growth of lambda on E coli K12, is called restriction.

Interestingly, restriction is rarely absolute Although

lambda virus grown on E coli K12 produces almost no

prog-viral particles do manage to proliferate If their progeny are The phenomenon in which growth on a restricting host mod-

ciently on that same host is known as modification.

What mechanisms account for restriction and cation? Studies following viral DNA after bacterial infec-

modifi-10 4

E coli K12—rare cell

E coli C

Lambda virus particle

Lysis—bacterium dies Lysis—bacterium dies

Bacterium lives No viruses produced

(1)

Figure A Operation of the restriction enzyme/modification

system in nature (1) E coli strain C does not have a functional

restriction enzyme/modification system and is susceptible to

infection by the lambda phage (2) In contrast, E coli strain K12

generall resists infection b the iral particles prod ced from

Fast Forward Essays

This feature is one of the methods used

to integrate the Mendelian principles

presented early in the book with the

molecular principles that will follow

HIV and Reverse Transcription: An Unusual DNA Polymerase Gives the AIDs Virus an Evolutionary Edge

The AIDS-causing human immunodeficiency virus (HIV) is the and clinical studies spanning more than a decade, researchers consisting of an outer envelope enclosing a protein matrix,

which, in turn, surrounds a cut-off cone-shaped core (Fig A).

cal single strands of RNA associated with many molecules of

an unusual DNA polymerase known as reverse transcriptase.

During infection, the AIDS virus binds to and injects its cone-shaped core into cells of the human immune system

(Fig B) It next uses reverse transcriptase to copy its RNA

genome into double-stranded DNA molecules in the plasm of the host cell The double helixes then travel to the mosome Once integrated into a host-cell chromosome, the the host cell’s protein synthesis machinery to make hundreds ing with them part of the cell membrane and sometimes re- inside the host chromosome, which then copies and transmits the viral genome to two new cells with each cell division.

cyto-The events of this life cycle make HIV a retrovirus: an

RNA virus that after infecting a host cell copies its own single zyme then integrates into a host chromosome RNA viruses the cellular machinery to make more of themselves, often

killing the host cell in the process The viruses that cause latter type of RNA virus Unlike retroviruses, they are not ber of new cells.

hep-Reverse transcription, the foundation of the retroviral life cycle, is inconsistent with the one-way, DNA-to-RNA-to- chapter Because it was so unexpected, the phenomenon of reverse transcription encountered great resistance in the

of the University of Wisconsin and David Baltimore, then of molecular genetics, DNA polymerases construct DNA poly- cal genome for transmission to daughter cells during the cell cycle; and RNA polymerases construct RNA polymers from a DNA template, copying the information of genes Reverse transcriptase, by comparison, is a remarkable DNA

an RNA or a DNA template.

Figure AStructure of the AIDS virus Figure BLife cycle of the AIDS virus

Core

HIV viral particle Protein matrix

RNA Reverse transcriptase Bilipid outer layer

Host cell

Host DNA

Virus particles attach to host cell membrane.

1.

2 Core disintegrates, releasing RNA.

Reverse transcriptase produces DNA from viral RNA genome.

3 DNA copy of virus genome enters nucleus.

4 DNA copy of virus genome integrates into host chromosome.

5 Transcription of integrated virus makes viral RNA genome.

6 Core forms; new virus particles bud from host cell.

CONFIRMING PAGES

Comprehensive Examples

Comprehensive Examples are extensive case

histories or research synopses that, through

text and art, summarize the main points in

the preceding section or chapter and show

how they relate to each other

Connections

Each chapter closes with a Connections section

that serves as a bridge between the topics in the

just-completed chapter and those in the upcoming

chapter or chapters

Connections

The existence of numerous controls in each of several cell-cycle pathways suggests that evolution has erected many barriers in multicellular animals to the uncontrolled reproduction of “selfish” cells At the same time, the hun- dreds of genes contributing to normal cell-cycle regula- tion provide hundreds of targets for cancer-producing mutations.

Variations on the theme of cell-cycle regulation play a key role in the development of eukaryotic organisms Dur- ing the development of multicellular organisms, cells must not only control their cell cycles, they must also adopt dif- ferent fates and differentiate into different tissues In

Drosophila,for example, after fertilization, nuclear sion occurs without cell division for the first 13 cycles;

divi-during these cycles, the nuclei go through many rapid S and M phases without any intervening or (Fig.

19.25) In cycles 10–13, the synthesis and degradation of cyclinB regulates mitosis Sometime during cycles 14–16,

a phase appears, and distinct patches of cells with ferent-length cycles become evident within the embryo.

dif-The differences in cycle time between the different cell types is the result of variable phases Late in

CDC25activates cyclin-dependent kinases to control the timing of mitosis Many tissues stop dividing at cycle 16, but a few continue In the still-dividing cells, a phase appears Some of these cells will arrest in during larval growth, only to start dividing again in response to signals relayed during metamorphosis.

In Chapter 20, we present the basic principles of velopment and describe how biologists have used genetic analysis in various model organisms to examine develop- ment at the cellular and molecular levels.

Figure 19.25 Regulation of the cell-cycle changes during

Drosophila development.Each step of development has built-in regulators that act as barriers to uncontrolled reproduction of

“selfish” cells Some of these regulators, such as cyclinB and

CDC25,are known; others are not.

Gene expression

Genes controlling cell cycle unknown

L A V

18.4 Sex Determination in Drosophila: A Comprehensive Example of Gene Regulation

Male and female Drosophila exhibit many sex-specific

dif-ferences in morphology, biochemistry, behavior, and

func-tion of the germ line (Fig 18.20) By examining the

phenotypes of flies with different chromosomal tions, researchers confirmed that the ratio of X to autoso- mal chromosomes (X:A) helps determine sex, fertility, and

constitu-viability (Table 18.2) They then carried out genetic

exper-iments that showed that the X:A ratio influences sex through three independent pathways: One determines whether the flies look and act like males or females; an- other determines whether germ cells develop as eggs or sperm; and a third produces dosage compensation through doubling the rate of transcription of X-linked genes in

Affects Phenotype in Drosophila Sex Chromosomes X:A Sex Phenotype

Autosomal Diploids

XO 0.5 Male (sterile)

XX 1.0 Female XXY 1.0 Female

Autosomal Triploids

XXX 1.0 Female XYY 0.33 Male XXY 0.66 Intersex

Figure 18.20 Sex-specific traits in Drosophila Objects or

traits shown in blue are specific to males Objects or traits shown

in red are specific to females Objects or traits shown in green are

found in different forms in the two sexes.

Antenna Sensillae

Foreleg Chemosensory axons

Sex comb in male

Abdomen Pigmentation

Male-specific muscle

Genitalia

Brain Regions determining courtship behaviors More Kenyon fibers in female mushroom body

Thoracic ganglion Courtship behaviors

Fat body Yolk proteins in female

Gonads and reproductive tract

In female:

Ovaries/oogenesis Yolk, chorion, and vitelline membrane proteins

blue = specific to males red = specific to females

green = found in different forms in the two sexes

In male:

Testes/spermatogenesis Accessory gland peptides Ejaculatory duct proteins

CONFIRMING PAGES

Feature Figure 4.13

Meiosis: One Diploid Cell Produces Four Haploid Cells

Prophase I: Leptotene

1 Chromosomes thicken and become

visible, but the chromatids remain

invisible.

2 Centrosomes begin to move toward

opposite poles.

Anaphase I

1 The centromere does not divide.

2 The chiasmata migrate off chromatid ends.

3 Homologous chromosomes move to opposite poles.

Metaphase I

1 Tetrads line up along the metaphase plate.

2 Each chromosome of a homologous pair attaches to fibers from opposite poles.

3 Sister chromatids attach to fibers from the same pole.

2 Crossing-over, genetic exchange between

nonsister chromatids of a homologous pair, occurs.

Meiosis I: A reductional division

2 Centrioles move toward the poles.

3 The nuclear envelope breaks down at the

end of prophase II (not shown).

Meiosis II: An equational division

Prophase I: Diplotene

1 Synaptonemal complex dissolves.

2 A tetrad of four chromatids is visible.

3 Crossover points appear as chiasmata,

which hold nonsister chromatids together.

4 Meiotic arrest occurs at this time in many species.

Telophase I

1 The nuclear envelope re-forms.

2 Resultant cells have half the number of chromosomes, each consisting of two sister chromatids.

Prophase I: Diakinesis

1 Chromatids thicken and shorten.

2 At the end of prophase I, the nuclear membrane (not shown earlier) breaks down, and the spindle begins to form.

Interkinesis

1 This is similar to interphase with one

important exception: No chromosomal

duplication takes place.

2 In some species, the chromosomes decondense; in others, they do not.

Cytokinesis

1 The cytoplasm divides, forming four new haploid cells.

Telophase II

1 Chromosomes begin to uncoil.

2 Nuclear envelopes and nucleoli (not shown) re-form.

Figure 4.13 To aid visualization of the chromosomes, the figure is simplified in two ways: (1) The nuclear envelope is not shown during prophase of either meiotic division (2) The chromosomes are shown

as fully condensed at zygotene; in reality, the chromosomes continue to condense throughout prophase such that full condensation does not occur until diakinesis.

CONFIRMING PAGES

Microtubules Centromere Chromosome Nuclear envelope Sister chromatids Centrosome

In animal cells Centriole

(a) Prophase: (1) Chromosomes condense and

become visible; (2) centrosomes move apart toward opposite poles and generate new microtubules; (3) nucleoli begin to disappear.

Astral microtubules Kinetochore Kinetochore microtubules Polar microtubules

(b) Prometaphase: (1) Nuclear envelope breaks

down; (2) microtubules from the centrosomes invade the nucleus; (3) sister chromatids attach

to microtubules from opposite centrosomes.

Metaphase plate

(c) Metaphase: Chromosomes align on the

metaphase plate with sister chromatids facing opposite poles.

Separating sister chromatids

(d) Anaphase: (1) Centromeres divide; (2) the now

separated sister chromatids move to opposite poles.

Nucleoli reappear

Re-forming nuclear envelope

Chromatin

(e) Telophase: (1) Nuclear membranes and

nucleoli re-form; (2) spindle fibers disappear;

(3) chromosomes uncoil and become a tangle

of chromatin.

(f) Cytokinesis: The cytoplasm divides, splitting

the elongated parent cell into two daughter cells with identical nuclei.

Figure 4.8 Mitosis maintains the chromosome number of the parent cell nucleus in the two daughter nuclei.In the

pho-tomicrographs of newt lung cells, chromosomes are stained blue and microtubules appear either green or yellow.

Process Figures

Step-by-step descriptionsallow the student to walkthrough a compact summary

1 Drop cells onto a glass slide 2 Gently denature DNA by treating

briefly with DNase.

3 Add hybridization probes labeled with fluorescent dye and wash away unhybridized probe.

Fluorescent probes Fluorescent dye

Fluorescence

microscope

Barrier filter 2 (further blockage of stray UV rays) Mirror to UV light; transparent to visible light

Objective lens Object Barrier filter 1 (blocks

dangerous short UV rays,

allows needed long UV

rays to pass through)

UV source

Eyepiece

4 Expose to ultraviolet (UV) light.

Take picture of fluorescent chromosomes.

(a)

Figure 10.8 The FISH protocol (a) The technique (1) First, drop cells arrested in the metaphase stage of the cell cycle onto a micro

scope slide The force of the droplet hitting the slide causes the cells to burst open with the chromosomes spread apart (2) Next, fix the

chromosomes and gently denature the DNA within them such that the overall chromosomal structure is maintained even though each

DNA double helix opens up at numerous points (3) Label a DNA probe with a fluorescent dye, add it to the slide, incubate the probe

with the slide long enough for hybridization to occur, and wash away unhybridized probe (4) Now place the slide under a special micro

scope that focuses ultraviolet (UV) light on the chromosomes The UV light causes the bound probe to fluoresce in the visible range of

the spectrum You can view the fluorescence through the eyepiece and photograph it (b) A fluorescence micrograph Photograph of a

baby hamster kidney cell subjected to FISH analysis It shows the microtubular structure.

(b)

Experiment and Technique Figures

Illustrations of performedexperiments and geneticanalysis techniques highlighthow scientific concepts andprocesses are developed

Figure 3.8 Plant incompatibility systems promote outbreeding and allele proliferation A pollen grain carrying an allele of the

self-incompatibility gene that is identical to either of the two alleles carried by a potential female parent is unable to grow a pollen tube; as a result, fertilization cannot take place Because all the pollen grains produced by any one plant have one of the two alleles carried by the female reproductive parts of the same plant, self-fertilization is impossible.

Egg cells (ovules)

"Female" parent (ovule donor)

"Male" parent (pollen donor)

Pollen tube growth allows fertilization

"Female" parent "Male" parent

Self-fertilization Parents

Fertilization

Progeny

No pollen tube growth

Egg cells deteriorate

Solving Genetics Problems

The best way for students to assess and increase their understanding of genetics is to practice

through problems Found at the end of each chapter, problem sets assist students in evaluating their

grasp of key concepts and allow them to apply what they have learned to real-life issues

Social and Ethical Issues

These challenging problems stir

discussion and debate The issues are

presented within the context of real-life

case studies and require the student to

consider not only scientific issues but

legal and ethical issues as well

Review Problems

Problems are organized by chapter section

and in order of increasing difficulty to help

students develop strong problem-solving

skills The answers to select problems can

be found in the back of this text

Solved Problems

Solved problems offer step-by-step

guidance needed to understand the

problem-solving process

Vocabulary

1.The following is a list of mutational changes For each the terms in the right-hand column applies, either as a More than one term from the right column can apply to each statement in the left column.

1 an A–T base pair in the wild-type gene is changed to a G–C pair

2 an A–T base pair is changed to a T–A pair

3 the sequence AAGCTTATCG is changed to AAGCTATCG

4 the sequence AAGCTTATCG is changed to AAGCTTTATCG

5 the sequence AACGTTATCG is changed to AATGTTATCG

6 the sequence AACGTCACACACACATCG is changed to AACGTCACATCG

7 the gene map in a given chromosome arm is changed from bog-rad-fox1-fox2-try-duf (where fox1 and fox2 are highly homologous, recently

diverged genes) to duf (where fox3 is a new gene with one end

bog-rad-fox1-fox3-fox2-try-similar to fox1 and the other similar to fox2)

8 the gene map in a chromosome is changed from

bog-rad-fox1-fox2-try-duf to fox1-try-duf

bog-rad-fox2-9 the gene map in a given chromosome is changed from bog-rad-fox1-fox2-try-duf to bog-rad-fox1-mel-qui-txu-sqm

Section 7.1

2.The DNA sequence of a gene from three mation, what is the sequence of the wild-type gene in this region?

independ-mutant 1 ACCGTAATCGACTGGTAAACTTTGCGCG mutant 2 ACCGTAGTCGACCGGTAAACTTTGCGCG mutant 3 ACCGTAGTCGACTGGTTAACTTTGCGCG

3.Over a period of several years, a large hospital kept trait achondroplasia Achondroplasia is a very rare au- abnormal body proportions After 120,000 births, it achondroplasia One physician was interested in deter- new mutations and whether the apparent mutation rate families of the 27 dwarf births and discovered that 4 of parent mutation rate of the achondroplasia gene in this

4.Among mammals, measurements of the rate of made almost exclusively in mice, while many mea- tions have been made both in mice and in humans.

gener-Why do you think there has been this difference?

5.In a genetics lab, Kim and Maria infected a sample from an E coli culture with a particular virulent bacte-

riophage They noticed that most of the cells were sample was about 1 ⫻ 10 ⫺4 Kim was sure the bacte-

riophage induced the resistance in the cells, while existed in the sample of cells they used Earlier, for a sion of E coli onto solid medium in a large petri dish,

and, after seeing that about 10 5 colonies were growing

up, they had replica-plated that plate onto three other test their theories They pipette a suspension of the What should they see if Kim is right? What should they see if Maria is right?

6.Suppose you wanted to study genes controlling the isolating bacterial mutants that are resistant to infection lection procedure is simple: Spread cells from a culture high concentration of phages, and pick the bacterial (1) spread cells from a single liquid culture of sensitive colony or (2) start many different cultures, each grown

from a single colony of sensitive bacteria, spread one from each plate Which method would ensure that you are isolating many independent mutations?

7.A wild-type male Drosophila was exposed to a large

dose of X-rays and was then mated to an unirradiated dominant mutation for the trait Bar eyes and several

inversions Many F 1 females from this mating were recovered who had the Bar, multiply inverted X chromo-

some from their mother, and an irradiated X chromosome offspring of these F 1 females will not have recombinant X chromosomes, as explained in Chapter 14.) After mating

to normal males, most F 1 females produced Bar and

wild type sons in equal proportions There were three

I.Mutations can often be reverted to wild type by verse a mutation gives us information about the nature exclusively causes transitions; proflavin is an interca- ultraviolet (UV) light causes single-base substitutions.

treat-Cultures of several E coli met⫺mutants were treated with three mutagens separately and spread onto a plate

⫺ indicates that no colonies grew, and ⫹ indicates that

some met ⫹revertant colonies grew.)

Mutagen treatment Mutant number EMS Proflavin UV light

Answer

To answer this question, you need to understand the concepts of mutation and reversion.

a Mutation 1 is reverted by the mutagen that causes

sition.Consistent with this conclusion is the fact the UV light can also revert the mutation and the

sion Mutation 2 is reverted by proflavin and

of a base.The other two mutagens do not revert mutation 2 Mutation 3 is not reverted by any of base substitution, a single-base insertion, or a

tion of several bases or an inversion.Mutation 4

is reverted by UV light, so it is a single-base change, but it is not a transition, since EMS did

transversion.

Solved Problems

1 Chemicals that are mutagenic are identified by the

Ames test, which measures the level of mutagenesis in bacteria The susceptibility of humans to mutagenic chemicals may vary depending on the genetic makeup

of the individual The dose that affects one person may be different from that which affects another.

However, there are few, if any, reliable tests that termine a person’s level of susceptibility If this is true, is it a good idea to translate the results of the Ames test of mutability in bacteria to a prediction of carcinogenicity in humans? Often, reports of Ames test results on a chemical make newspaper headlines.

de-Is this a useful and honest way to report findings that could affect human health, or do people need to con- sider other variables to make an informed decision?

2 Mr and Mrs Aswari have a child with fragile X

syndrome (see the Genetics and Society box on

p 216–217) They want to have a second child but are considering egg donation because genetic screening has indicated that Mrs Aswari carries a premutation allele with 120 CGG repeats If you were the Aswari’s genetic counselor, what would you tell them about their risk of having a second child with fragile X syndrome? What are the ethical issues related to genetic screening when (1) a result indicates no risk, (2) a result indicates that the phenotype being screened for will be exhibited, and (3) an intermediary result does not clearly fall into either category?

Social and Ethical Issues

CONFIRMING PAGES

Media and Supplements

For the Instructor

ARIS Presentation Center

Build instructional materials where-ever, when-ever, and

how-ever you want! ARIS Presentation Center is an online

digital library containing assets such as photos, artwork,

animations, PowerPoints, and other media types that can

be used to create customized lectures, visually enhanced

tests and quizzes, compelling course websites, or attractive

printed support materials

Nothing could be easier! Accessed from the instructor

side of your textbook’s ARIS website, Presentation

Center’s dynamic search engine allows you to explore by

discipline, course, textbook chapter, asset type, or keyword

Simply browse, select, and download the files you need to

build engaging course materials All assets are copyright

McGraw-Hill Higher Education but can be used by

instruc-tors for classroom purposes

Instructor’s Testing and Resource CD-ROM

This cross-platform CD features a computerized test bank

that uses testing software to quickly create customized

exams The user-friendly program allows instructors to

search for questions by topic, format, or difficulty level;

edit existing questions or add new ones; and scramble

questions for multiple versions of the same test

McGraw-Hill ARIS—Assessment, Review, and

Instruction System

McGraw-Hill’s ARIS is a complete, online electronic

home-work and course management system, designed for greater

ease of use than any other system available Created

specifi-cally for Genetics: From Genes to Genomes, third edition,

instructors can create and share course materials and

assign-ments with colleagues with a few clicks of the mouse

For instructors, personal response system questions, all

PowerPoint lectures, and assignable content are directly

tied to text-specific materials in Genetics: From Genes to

Genomes Instructors can also edit questions, import their

own content, and create announcements and due dates for

assignments Also included on the ARIS site is the

Instructors’s Manual and Integration Guide This manual

provides a guide to integrating all the available resources

for Genetics: From Genes to Genomes into your course

presentations

ARIS has automatic grading and reporting of

easy-to-assign homework, quizzing, and testing All student

activ-ity within McGraw-Hill’s ARIS is automatically recorded

and available to the instructor through a fully integrated

grade book that can be downloaded to Excel

For students, there are multiple-choice quizzes,

ani-mations with quizzing, web interactive exercises, and even

more materials that may be used for self-study or in bination with assigned materials

com-Go to aris.mhhe.com to learn more and register!

PageOut

McGraw-Hill’s exclusive tool for creating your own websitefor your genetics course It requires no knowledge of codingand is hosted by McGraw-Hill

Course Management Systems

ARIS content compatible with online course managementsystems like WebCT and Blackboard makes puttingtogether your course website easy Contact your localMcGraw-Hill sales representative for details

Transparencies

150 four-color illustrations from the book will be available

to adopters

For the Student

Solutions Manual/Study Guide

ISBN 978-0-07-299587-9MHID 0-07-299587-4Extensively revised by Dr Debra Nero of CornellUniversity, this manual presents the solutions to the end-of-chapter problems and questions along with the step-by-step logic of each solution The manual also includes asynopsis, the objectives, and problem-solving tips for eachchapter Key figures and tables from the textbook are ref-erenced throughout to guide student study

McGraw-Hill’s ARIS

(Assessment Review and Instruction System)Makes homework meaningful—and manageable—forinstructors and students

Explore this dynamic site for a variety of study tools

• Self-quizzes test your understanding of key concepts.

• Flash cards ease learning of new vocabulary.

• Animations bring key genetic concepts to life and are followed by a quiz to test your understanding.

• On Our Website content includes downloadable PDF

files of new material, and easy access to articles andwebsites related to the concepts of individual chapters

• Interactive Web Exercises guide your exploration of

key genetic databases These exercises include an ment so you can apply what you’ve discovered in thedatabases to the concepts covered in the textbook chapter

assign-Go to aris.mhhe.com to learn more or go directly to

Genetics: From Genes to Genomes CD-ROM, developed

with the content of this book, covers the most challengingconcepts in the introductory genetics course The CD presentsanimations of basic genetic processes, interactive exercises,and simulations involving fundamental principles Additionalquizzing options allow students to self-test and identify thoseareas needing additional study Glossary definitions can bereached via hot links A correlation guide linking book topics

to the related CD material is included on the CD

CONFIRMING PAGES

Preface xxi

Acknowledgments

The creation of a project of this scope is never solely the

work of the authors We are grateful to our colleagues

around the world who took the time to review this

manu-script and make suggestions for its improvement Their

willingness to share their experiences and expertise was a

tremendous help to us

Third Editewers

Dr Michael Abler, University of Wisconsin, La Crosse

Amelia J Ahern-Rindell, University of Portland

Robert Angus, University of Alabama, Birmingham

Arthur R Ayers, Albertson College of Idaho

Vernon W Bauer, Francis Marion University

Robert E Braun, University of Washington School

of Medicine

Kirk Cammarata, Texas A&M University, Corpus Christi

James J Campanella, Ph.D., Montclair State University

J Aaron Cassill, University of Texas, San Antonio

Kerry L Cheesman, Ph.D., Capital University

Richard W Cheney, Jr., Christopher Newport University

Yury O Chernoff, Georgia Institute of Technology

Ruth Chesnut, Eastern Illinois University

Michael J Christoffers, North Dakota State University

Thomas W Cline, University of California, Berkeley

Bruce Cochrane, University of South Florida, Tampa

Bernard P Duncker, University of Waterloo

Christine Dupont, University of Waterloo

Bert Ely, University of South Carolina

William F Ettinger, Gonzaga University

Ann P Evancoe, Hudson Valley Community College

Rebecca V Ferrell, Metropolitan State College of Denver

Victor Fet, Marshall University

David Foltz, Louisiana State University

Wayne C Forrester, Indiana University

Robert G Fowler, San Jose State University

Sylvia Fromherz, University of Colorado at Boulder

Julia Frugoli, Clemson University

Anne M Galbraith, University of Wisconsin, La Crosse

Gail E Gasparich, Towson University

Dr Nabarun Ghosh, Ph.D., West Texas A&M University

Susan Godfrey, University of Pittsburgh

Michael A Goldman, Ph.D., San Francisco State University

Elliott Goldstein, Arizona State University

Deborah J Good, Virginia Polytechnic Institute and

State University

Nels H Granholm, Ph.D., South Dakota State University

Robert Gregerson, Lyon College

Martha Hamblin, Cornell University

Pamela L Hanratty, Indiana University

Pamela K Hanson, Birmingham-Southern College

Stephen C Hedman, University of Minnesota

Peter W Hoffman, Ph.D., College of Notre Dame of Maryland

Bruce Hofkin, University of New Mexico Nancy M Hollingsworth, State University of New York,

Stony Brook

Laura L Mays Hoopes, Pomona College Kamal M Ibrahim, Southern Illinois University Bob Ivarie, University of Georgia

Bradley Jett, Ph.D., Oklahoma Baptist University Gregg Jongeward, University of the Pacific Todd Kelson, Brigham Young University, Idaho Stephen T Kilpatrick, University of Pittsburgh, Johnstown Deborah A Kimbrell, University of California, Davis Bruce Kohorn, Bowdoin College

Sidney Kushner, University of Georgia John C Larkin, Louisiana State University Howard Laten, Loyola University, Chicago Elena Levine Keeling, California Polytechnical

Scott D Michaels, Indiana University Robert Moss, Ph.D., Wofford College Mary Rengo Murnik, Ferris State University Stuart J Newfeld, Arizona State University John C Osterman, University of Nebraska, Lincoln

Dr David K Peyton, Morehead State University Gregory J Podgorski, Utah State University James V Price, Utah Valley State College Rongsun Pu, Kean University

David H Reed, University of Mississippi Jennifer L Regan, University of Southern Mississippi David L Remington, University of North Carolina,

Stanford University

James H Thomas, University of Washington Doug Thrower, University of California, Santa Barbara Jonathan E Visick, North Central College

Alan S Waldman, University of South Carolina

Dr Sarah Ward, Colorado State University Ted Weinert, University of Arizona David R Wessner, Davidson College Matthew M White, Ohio University Robert Wiggers, Stephen F Austin State University David Wofford, University of Florida, Gainesville Yang Yen, South Dakota State University

Jianzhi Zhang, University of Michigan

CONFIRMING PAGES

Second-Edition Reviewers

Lawrence R Aaronson, Utica College

Ruth Ballard, California State University, Sacramento

Mary Bedell, University of Georgia

Michelle Bell, Xavier University

Michael Benedik, University of Houston

Susan Bergeson, University of Texas

David Carroll, Florida Institute of Technology

Helen Chamberlin, Ohio State University

Ruth Chesnut, Eastern Illinois University

Bruce Cochrane, University of South Florida

Claire Cronmiller, University of Virginia

Mike Dalbey, University of California, Santa Cruz

David Durica, University of Oklahoma

David Duvernell, Southern Illinois University

Sarah Elgin, Washington University

Johnny El-Rady, University of South Florida

Victor Fet, Marshall University

Janice Fisher, University of Texas, Austin

David Foltz, Louisiana State University

Jim Ford, Stanford University

David Fromson, California State University, Fullerton

Anne Galbraith, University of Wisconsin, La Crosse

Peter Gergen, SUNY Stony Brook

Elliot Goldstein, Arizona State University

James Haber, Brandeis University

Ralph Hillman, Temple University

Nancy Hollingsworth, SUNY Stony Brook

Jackie Peltier Horn, Houston Baptist University

Shelley Jansky, University of Wisconsin,

Stevens Point

Eric N Jellen, Brigham Young University

Cheryl Jorcyk, Boise State University

Kathleen Karrer, Marquette University

Sean Kimbro, Clark Atlanta University

Rebecca Kohn, Ursinus College

Stanley Maloy, University of Illinois

Steve McCommas, Southern Illinois University,

Edwardsville

Elliot M Meyerowitz, California Institute

of Technology

Leilani Miller, Santa Clara University

Roderick M Morgan, Grand Valley State University

Nick Norton, Southeastern Louisiana University

Valerie Oke, University of Pittsburgh

Greg Podgorski, Utah State University

Jim Prince, California State University, Fresno

Inder Saxena, University of Texas

Daniel Schoen, McGill University

Mark Seeger, Ohio State University

Malcolm Shields, University of West Florida

David Smith, University of Delaware

Harold Vaessin, Ohio State University

Dan Wells, University of Houston

Andrew Wood, Southern Illinois University

Stephen D’Surney, University of Mississippi Rick Duhrkopf, Baylor University

Susan Dutcher, University of Colorado DuWayne Englert, Southern Illinois University Bentley Fane, University of Arkansas

Victoria Finnerty, Emory University David Foltz, Louisiana State University David Futch, San Diego State University Ann Gerber, University of North Dakota Richard Gethmann, University of Maryland,

Baltimore County

Mike Goldman, San Francisco State University Elliott Goldstein, Arizona State University Nels Granholm, South Dakota State University Charles Green, Rowan College of New Jersey Poonam Gulati, University of Houston Stephen Hedman, University of Minnesota Ralph Hillman, Temple University Christine Holler-Dinsmore, Fort Peck Community

R C Jackson, Texas Technological University Duane Johnson, Colorado State University Chris Kaiser, Massachusetts Institute of Technology Kenneth J Kemphues, Cornell University

Susan Kracher, Purdue University Alan Koetz, Illinois State University Andrew Lambertsson, University of Oslo Don Lee, University of Nebraska John Locke, University of Alberta Larry Loeb, University of Washington Robertson McClung, Dartmouth College Peter Meacock, University of Leicester John Merriam, University of California,

Los Angeles

Beth Montelone, Kansas State University

CONFIRMING PAGES

Preface xxiii

Patricia Moore, Transylvania University

Gail Patt, Boston University

Michael Perlin, University of Louisville

Richard Richardson, University of Texas, Austin

Mary Rykowski, University of Arizona

Mark Sanders, University of California, Davis

Randall Scholl, Ohio State University

David Sheppard, University of Delaware

Anthea Stavroulakis, Kingsborough Community College

John Sternick, Mansfield University

David Sullivan, Syracuse University

William Thwaites, San Diego State University

Akfi Uzman, University of Houston

Peter Webster, University of Massachusetts

Dean Whited, North Dakota State University

John Williamson, Davidson College

John Zamora, Middle Tennessee State University Stephan Zweifel, Carleton College

A special thank you to Nancy Hollingsworth andMartha Hamblin for their extensive feedback and toMalcolm Schug, Ronald Strohmeyer, and MichaelWindelspecht for their work on the ancillary materials thataccompany this book

We would also like to thank the highly skilled ing professionals at McGraw-Hill who guided the develop-

publish-ment and production of the third edition of Genetics: From

Genes to Genomes: Patrick Reidy for his sponsorship and

support; Rose Koos for her organizational skills and tirelesswork to tie up all the loose ends; and Joyce Berendes andher production team for their careful attention to detail andability to move the schedule along

CONFIRMING PAGES

CONFIRMING PAGES

Introduction to Genetics in the Twenty-First Century

Genetics: The Study of

1

Fundamental to Life Is Encoded

in the DNA Molecule

The process of evolution has taken close to 4 billion

years to generate the amazingly efficient mechanisms for

storing, replicating, expressing, and diversifying

biolog-ical information seen in organisms now inhabiting the

earth The linear DNA molecule stores biological

infor-mation in units known as nucleotides Within each DNA

molecule, the sequence of the four letters of the DNAalphabet—G, C, A, and T—specify which proteins anorganism will make as well as when and where proteinsynthesis will occur The letters refer to the bases—guanine, cytosine, adenine, and thymine—that arecomponents of the nucleotide building blocks of DNA.The DNA molecule itself is a double strand of nu-cleotides carrying complementary G–C or A–T base

pairs (Fig 1.2) These complementary base pairs can

bind together through hydrogen bonds The molecularcomplementarity of double-stranded DNA is its mostimportant property and the key to understanding howDNA functions

Genetics, the science of heredity, is at its core the study

of biological information All living organisms—from

single-celled bacteria and protozoa to multicellular

plants and animals—must store, replicate, transmit to

the next generation, and use vast quantities of

information to develop, reproduce, and survive in their

environments (Fig 1.1) Geneticists examine how

organisms pass biological information on to their

progeny and how they use it during their lifetime

This book introduces the field of genetics as it exists

in the first decade of the twenty-first century Seven

overarching themes recur throughout our presentation:

• The biological information fundamental to life is

encoded in the DNA molecule

• Biological function emerges primarily from protein

molecules

• Complex biological systems emerge from the

functioning of regulatory networks that specify the behavior of genes and teins

pro-• All living forms are descended from a common ancestor and therefore closely

related at the molecular level

• The modular construction of genomes has allowed the rapid evolution of

biologi-cal complexity

• Genetic techniques permit the dissection of biological complexity

• Our focus is on human genetics

In the remainder of this chapter, we introduce these themes It will help to keepthem in mind as you delve into the details of genetics

Information can be stored in many ways, including the patterns of letters and words in books and the sequence of nucleotides in DNA molecules.

(d) Mouse

2 Chapter 1 Genetics: The Study of Biological Information

Figure 1.1 The biological information in DNA generates an enormous diversity of living organisms.

(a) Bacteria

(b) Dolphin

(c) Plants

(e) Humans

Although the DNA molecule is three-dimensional, most

of its information is one-dimensional and digital Theinformation is one-dimensional because it is encoded as aspecific sequence of letters along the length of the molecule

It is digital because each unit of information—one of the fourletters of the DNA alphabet—is discrete Because geneticinformation is digital, it can be stored as readily in a computermemory as in a DNA molecule Indeed, the combined

power of DNA sequencers (Fig 1.3), computers, and DNA

Figure 1.3 An automated DNA sequencer This instrument

can sequence about 1,000,000 base pairs a day.

G

C G T

T C P

O O

O P

P O

O

5'

3' 5'

3'

Figure 1.2 Complementary base pairs are a key feature of

the DNA molecule A single strand of DNA is composed of

nucleotide subunits each consisting of a deoxyribose sugar

(depicted here as a white pentagon), a phosphate (depicted as a

thymine, cytosine, or guanine (designated as lavender or green

A’s, T’s, C’s, or G’s) The chemical structure of the bases enables A

to associate tightly with T, and C to associate tightly with G

through hydrogen bonding As a result, A and T form one kind of

complementary base pair, while C and G form another kind of

complementary base pair The association through base pairing of

two complementary DNA strands produces a DNA double helix.

The arrows labeled 5 to 3 show that the two strands of the

dou-ble helix have opposite orientations relative to chemically distinct

5  and 3 ends.

synthesizers makes it possible to interpret, store, replicate,

and transmit genetic information electronically from one

place to another anywhere on the planet Such electronic

wizardry works something like this: A DNA sequencer reads

the base sequence of a DNA molecule The sequence

information is stored in a computer The computer transmits

the information via satellite from New York to a receiver in

Hong Kong or Paris There, the information is fed into a DNA

synthesizer, which makes an exact replica of a portion of the

originally sequenced DNA molecule

The DNA regions that encode proteins are called

genes Just as the limited number of letters in a written

alphabet places no restrictions on the stories one can tell,

so too the limited number of letters in the genetic code

alphabet places no restrictions on the kinds of proteins

and thus the kinds of organisms genetic information can

define The basic genetic language is virtually the same for

all organisms, whether single-cell bacteria or multicellular

humans The differences are in the content and amount of

information, and in when and where that information is

expressed, that is, converted to protein.

Within the cells of an organism, DNA molecules

carry-ing the genes are assembled into chromosomes: organelles

that package and manage the storage, duplication,

expres-sion, and evolution of DNA (Fig 1.4) The entire collection

of chromosomes in each cell of an organism is its genome.

Human cells, for example, contain 24 distinct kinds of

base pairsand roughly 20,000–30,000 genes The amount of informa-

tion that can be encoded in this size genome is equivalent to

6 million pages of text containing 250 words per page, with

each letter corresponding to one base pair, or pair of

nu-cleotides It may seem incredible that it takes only 3 billion

base pairs of genetic information to develop a human being,

from its basic body plan to the initiation of consciousness

To appreciate the long journey from a finite amount of

genetic information easily storable on a computer disk to

the production of a human being, it is necessary to examineproteins, the molecules that determine how complex sys-tems of cells, tissues, and organisms function

Primarily from Protein Molecules

Although there is no single characteristic that distinguishesliving organisms from inanimate matter, you would have lit-tle trouble deciding which entities in a group of 20 objectsare alive Over time, these living organisms, governed bythe laws of physics and chemistry as well as a genetic pro-gram, would be able to reproduce themselves Most of theorganisms would also have an elaborate and complicatedstructure Consider the fly It lays eggs, which hatch into lar-vae, which metamorphose at the appropriate time into adultflies Yet another characteristic of life is the ability to move.Animals swim, fly, walk, or run, while plants grow toward

or away from light Still another characteristic of living ganisms is the capacity to adapt selectively to the environ-ment, whether it be a robin choosing materials to build anest or a vine weaving its way up a fence Finally, a keycharacteristic of living organisms is the ability to usesources of energy and matter to grow, that is, the ability toconvert foreign material into their own body parts Thechemical and physical reactions that carry out these conver-

or-sions are known as metabolism.

Most properties of living organisms ultimately arise

from the class of molecules known as proteins—large

polymers composed of hundreds to thousands of acid subunits strung together in long chains; each chainfolds into a specific three-dimensional conformation dic-

amino-tated by the sequence of its amino acids (Fig 1.5) There

are 20 different amino acids The information in the DNA

of genes dictates, via a genetic code, the order of aminoacids in a protein molecule

You can think of proteins as constructed from a set of

20 different kinds of snap beads distinguished by color andshape; if you were to arrange the beads in any order, makestrings of a thousand beads each, and then fold or twist thechains into shapes dictated by the order of their beads, youwould be able to make a nearly infinite number of differentthree-dimensional shapes The astonishing diversity ofthree-dimensional protein structure generates the extraor-dinary diversity of protein function that is the basis of eachorganism’s complex and adaptive behavior The structureand shape of the hemoglobin protein, for example, allow it

to transport oxygen in the bloodstream and release it to thetissues The proteins myosin and actin can slide together toallow muscle contraction Chymotrypsin and elastase areenzymes that help break down other proteins Most of the

1.2 Biological Function Emerges Primarily from Protein Molecules 3

Figure 1.4 One of 24 different types of human

chromosomes Each chromosome contains thousands of genes.

4 Chapter 1 Genetics: The Study of Biological Information

NH2

CH3

CH COOH NH2

CH2C

Tyrosine

Alanine

(a)

Chymotrypsin

Elastase GQLAQTLQQAYLPTVDYA I CSSSSYWGSTVKNSMVCAGGDGVRS

ANTPORLQQASLPLLSNTNCKK- -Y WGT KI KDAM I CAGAS - GVS 149

189

A = Ala = alanine G = Gly = glycine M = Met = methionine S = Ser = serine

C = Cys = cysteine H = His = histidine N = Asn = asparagine T = Thr = threonine

D = Asp = aspartic acid I = Ile = isoleucine P = Pro = proline V = Val = valine

E = Glu = glutamic acid K = Lys = lysine Q = Gln = glutamine W = Trp = tryptophan

F = Phe = phenylalanine L = Leu = leucine R = Arg = arginine Y = Tyr = tyrosine

Figure 1.5 Proteins are polymers of amino acids that fold in three dimensions The specific sequence of amino acids in a chain

determines the precise three-dimensional shape of the protein (a) Chemical formulas for two amino acids: alanine with a relatively simple

CH3side chain and tyrosine with a more complex aromatic side chain All amino acids have a basic amino group (–NH) at one end and an acidic carboxyl group (–COOH) at the other The specific side chain (here the simple –CH3 or the more complex –CH2 plus aromatic ring

structure) determines the amino acid’s chemical properties (b) A comparison of equivalent segments in the chains of two digestive

proteins, chymotrypsin and elastase The red lines connect sites in the two sequences that carry identical amino acids; the two chains differ

at all the other sites shown Thus, even though these two proteins are evolutionarily related to each other, they differ at enough amino

acids that their structures and functions are not identical (c) Schematic drawings of the hemoglobin  chain (green) and lactate

dehydro-genase (purple) show the different three-dimensional shapes determined by different amino-acid sequences The  chain is part of the complex hemoglobin molecule, which binds and delivers oxygen to body tissues Lactate dehydrogenase is an enzyme that catalyzes energy conversions in microorganisms such as yeast and in the muscle cells of animals.

properties associated with life emerge from the

constella-tion of protein molecules that an organism synthesizes

according to instructions contained in its DNA

DNA-Protein and Protein Interactions

Protein-In addition to DNA and protein, a third level of biological

information encompasses dynamic interactions among

DNA, protein, and other types of molecules as well as

interactions among cells and tissues These complex

inter-active networks represent biological systems that function

both within individual cells and among groups of cells

within an organism Here we use biological system to

mean any complex network of interacting molecules orgroups of cells that function in a coordinated mannerthrough dynamic signaling There are several layers of bi-ological systems The human pancreas, for example, is anisolated biological system that operates within the largerbiological system of the human body and mind A wholecommunity of animals, such as a colony of ants that func-tions in a highly coordinated manner, is also a biologicalsystem

The information that defines any biological system isfour-dimensional because it is constantly changing over thethree dimensions of space and the one dimension of time.One of the most complex examples of this level of biologicalinformation (other than an entire human being) is the human

through perhaps 1018(1,000,000,000,000,000,000) junctionsknown as synapses From this enormous biological network,

based ultimately on the information in DNA and protein,

arises properties such as memory, consciousness, and the

ability to learn (Fig 1.6).

1.4 All Living Things Are Closely

Related at the Molecular Level

The evolution of biological information is a fascinating story

spanning the 4 billion years of earth’s history Many biologists

think that RNA was the first information-processing molecule

to appear Very similar to DNA, RNA molecules are also

composed of four subunits: the bases G, C, A, and U (for

uracil, which replaces the T of DNA) Like DNA, RNA has

the capacity to store, replicate, mutate, and express

informa-tion; like proteins, RNA can fold in three dimensions to

pro-duce molecules capable of catalyzing the chemistry of life

RNA molecules, however, are intrinsically unstable Thus, it

is probable that the more stable DNA took over the linear

in-formation storage and replication functions of RNA, while

proteins, with their far greater capacity for diversity,

pre-empted the functions derived from RNA’s three-dimensional

folding The information contained in the sequence of DNA

nucleotides then came to specify the sequence of amino acids

in the proteins With this division of labor, RNA became an

in-termediary in converting the information in DNA into the

se-quence of amino acids in protein The DNA letters G, C, A,

and T are informationally equivalent to the RNA letters G, C,

A, and U (Fig 1.7a) The separation that placed information

storage in DNA and biological function in proteins was so

successful that all organisms alive today descend from the first

organisms that happened upon this molecular specialization

The evidence for the common origin of all living forms

is present in their DNA sequences All living organisms use

essentially the same genetic code in which various triplet

groupings of the 4 letters of the DNA and RNA alphabetsencode the 20 letters of the amino-acid alphabet Via thecode, the order of bases in any organism’s DNA specifies

the amino-acid sequence of its proteins (Fig 1.7b).

The relatedness of all living organisms is also evidentfrom comparisons of genes with similar functions in verydifferent organisms For example, there is striking similaritybetween the genes for many proteins in bacteria, yeast,

plants, worms, flies, mice, and humans (Fig 1.8) Moreover,

it is often possible to place a gene from one organism intothe genome of a very different organism and see it functionnormally in the new environment Human genes that helpregulate cell division, for example, can replace related genes

in yeast and enable the yeast cells to function normally.One of the most striking examples of relatedness atthis level of biological information was uncovered in stud-ies of eye development Both insects and vertebrates(including humans) have eyes, but they are of very different

types (Fig 1.9) Biologists had long assumed that the

evo-lution of eyes occurred independently in the lineages ing to present-day insects and present-day vertebrates.Indeed, in many evolution textbooks, eyes are used as an

lead-example of convergent evolution, that is, of evolution in

which structurally unrelated but functionally analogous gans emerge in different species as a result of natural se-

or-lection Studies of a gene called the Pax6 gene have turned this view upside down Pax6 is one of nine genes encoding

proteins with a “paired box” structure that enables them tobind to DNA and regulate the expression of other genes

Mutations in the Pax6 gene lead to a failure of eye

de-velopment in both people (with a condition known asanirida) and mice, and molecular studies have suggested

that Pax6 might play a central role in the initiation of eye

development in all vertebrates Remarkably, when the

human Pax6 gene is expressed in cells along the surface of

the fruit fly body, it induces numerous little eyes to developthere This result demonstrates that there was a singleorigin of the eye in an ancestor common to flies and people

1.4 All Living Things Are Closely Related at the Molecular Level 5

1-dimensional

DNA

3-dimensional protein

4-dimensional human brain

4-dimensional cells (neurons)

and that, after 600 million years of divergent evolution,

both vertebrates and insects still share the same main

con-trol switch for initiating eye development Indeed, the eyes

of all multicellular organisms, not just those of vertebrates

and insects, may have a common evolutionary origin

Stud-ies of many other genes have shown that the entire

devel-opmental program of flies and people uses many of the

same genes These genes have duplicated and evolved

divergent functions, but they still retain their ancestral

relationship markings

The utility of the finding of relatedness and unity at alllevels of biological information cannot be overstated Itmeans that in many cases, the experimental manipulation of

organisms known as model organisms can shed light on

complex networks in humans Model organisms for geneticanalysis are amenable to breeding experiments and directmanipulation of their genomes If genes similar to humangenes function in simple model organisms such as fruit flies

or bacteria scientists can determine gene function and lation in these experimentally manipulable organisms and

regu-6 Chapter 1 Genetics: The Study of Biological Information

UUC UCC UAC UGC

UUA UCA UAA UGA

UUG UCG UAG UGG

CUU CCU CAU CGU

CUC CCC CAC CGC

CUA CCA CAA CGA

CUG CCG CAG CGG

AUU ACU AAU AGU

AUC ACC AAC AGC

AUA ACA AAA AGA

AUG ACG AAG AGG

GUU GCU GAU GGU

Arg

Asn Lys

His Gln

Arg

Cys Stop Stop

Stop Trp

Tyr

G

U C A

G

U C A

G

U C A

G

U C A

Figure 1.7 RNA is an intermediary in the conversion of

DNA information into protein via the genetic code (a) The

linear bases of DNA are copied through molecular complementarity

into the linear bases of RNA The bases of RNA are read three at a

time, that is, as triplets, to encode the amino-acid subunits of

proteins (b) The genetic code dictionary specifies the relationship

between RNA triplets and the amino-acid subunits of proteins.

(Note that this table uses three-letter abbreviations of the 20

amino acids, whose names are spelled out in Fig 1.5.)

D melanogaster -AGDVEKGKKLFVQRCAQCHTVEAGGKHKV

D melanogaster GPNLHGL I GRKTGQAAGFAYTDANKAKG I TW

D melanogaster NEDT L F EYLENPKKY IPGTKM I FAGLKKPNER

* Indicates identical and indicates similar

Figure 1.8 Comparisons of gene products in different species provide evidence for the relatedness of living organisms This

chart shows the amino-acid sequence for equivalent portions of the

cytochrome C protein in six species: Saccharomyces cerevisiae (yeast),

Fig 1.5 for the key to amino-acid names Cytochrome C functions during cellular respiration and photosynthesis The most abundant and most stable of the cytochromes, its form and function have been conserved throughout evolution As the chart shows, there are many sequence similarities among the six types of organisms

from a single primordial gene by several duplications lowed by slight divergences in structure.

fol-Duplication followed by divergence underlies the lution of new genes with new functions This principleappears to have been built into the genome structure of alleukaryotic organisms The protein-coding region of mostgenes is subdivided into as many as 10 or more small

evo-pieces (called exons), separated by DNA that does not code for protein (called introns) as shown in Fig 1.10 This modu-

lar construction facilitates the rearrangement of differentmodules from different genes to create new combinationsduring evolution It is likely that this process of modular re-assortment facilitated the rapid diversification of livingforms about 570 million years ago (see Fig 1.10)

The tremendous advantage of the duplication anddivergence of existing pieces of genetic information is

evident in the history of life’s evolution (Table 1.1).

Prokaryotic cells such as bacteria, which do not have a

membrane-bounded nucleus, evolved about 3.7 billion

years ago; eukaryotic cells such as algae, which have a

membrane-bounded nucleus, emerged around 2 billionyears ago; and multicellular eukaryotic organisms ap-peared 600–700 million years ago Then, at about 570 mil-lion years ago, within the relatively short evolutionary time

of roughly 20–50 million years known as the Cambrian plosion, the multicellular life-forms diverged into a bewil-dering array of organisms, including primitive vertebrates

ex-A fascinating question is, since it took eukaryotic cellsalmost 2 billion years to evolve from prokaryotic cells andmulticellular organisms three-quarters of a billion years toevolve from single-celled eukaryotes, how could the multi-cellular forms achieve such enormous diversity in only20–50 million years? The answer lies, in part, in the hierar-chic organization of the information encoded in chromo-somes Exons are arranged into genes; genes duplicate anddiverge to generate multigene families; and multigene fam-ilies sometimes rapidly expand to gene superfamilies con-taining hundreds of related genes In both mouse andhuman adults, for example, the immune system is encoded

1.5 The Modular Construction of Genomes Has Allowed the Relatively Rapid Evolution of Complexity 7

bring these insights to an understanding of the human

organ-ism The same is true of the shared informational pathways

such as DNA replication and protein synthesis You can visit

ge-netic portraits of five key model organisms: the yeast S

cere-visiae, the simple plant known as A thaliana, the

roundworm C elegans, the fruit fly D melanogaster, and the

house mouse M musculus.

The close relatedness of all living organisms at the lecular level has great significance for an understanding of

mo-biology It makes it possible to combine bits and pieces

learned from different organisms into a global

understand-ing of molecular and cellular biology that is valid for all

organisms And even though controlled experimentation

with humans is usually impossible, the relatedness of all

organisms allows us to learn about human biology from

mice, flies, worms, peas, yeast, and other organisms that

are accessible to experimentation

Genomes Has Allowed the Rapid Evolution of Complexity

We have seen that roughly 20,000–30,000 genes direct

hu-man growth and development How did such complexity

arise? Recent technical advances have enabled researchers to

complete structural analyses of the entire genome of more

than 250 organisms The information obtained reveals that

families of genes have arisen by duplication of a primordial

gene; after duplication, mutations and rearrangements may

cause the two copies to diverge from each other (Fig 1.10).

In both mice and humans, for example, five different

hemo-globin genes produce five different hemohemo-globin molecules at

successive stages of development, with each protein

func-tioning in a slightly different way to fulfill different needs for

oxygen transport The set of five hemoglobin genes arose

Figure 1.9 The eyes of insects and humans have a common

ancestor (a) A fly eye and (b) human eye.

Ancestral gene A

Duplication

Two exact copies of gene A

Further duplication and divergence from mutations and DNA rearrangements

Figure 1.10 How genes arise by duplication and divergence.

Duplications of ancestral gene A followed by mutations and DNA rearrangements generate a family of related genes The dark blue and red bands indicate the different exons of the genes while the

8 Chapter 1 Genetics: The Study of Biological Information

by a gene superfamily composed of hundreds of closely

related but slightly divergent genes With the emergence of

each successively larger informational unit, evolution gains

the ability to duplicate increasingly complex informational

cartridges through single genetic events

Probably even more important for the evolution ofcomplexity is the rapid change of regulatory networks thatspecify how genes behave (that is, when, where, and towhat degree they are expressed) during development Forexample, the two-winged fly evolved from a four-wingedancestor not because of changes in gene-encoded structuralproteins, but rather because of a rewiring of the regulatorynetwork, which converted one pair of wings into two bal-

ancing organs known as haltere (Fig 1.11).

the Dissection of Complexity

The complexity of living systems has developed over 4 billionyears from the continuous amplification and refinement of ge-netic information The simplest bacterial cells contain about

1000 genes that interact in complex networks Yeast cells, thesimplest eukaryotic cells, contain about 6,000 genes Nema-todes (roundworms) and fruit flies, the simplest multicellularorganisms, contain roughly 14,000– 19,000 genes; humansmay have as many as 30,000 genes The Human Genome Pro-ject, in addition to completing the sequencing of the entire hu-

man genome, has sequenced the genomes of E coli, yeast, the

nematode, the fruit fly, and the mouse (Fig 1.12) Each of

these organisms has provided valuable insights into biology ingeneral and human biology in particular

With genetic techniques, researchers can dissect thecomplexity of a genome piece by piece, although the task isdaunting The logic used in genetic dissection is quite sim-ple: inactivate a gene in a model organism and observe theconsequences For example, loss of a gene for visualpigment produces fruit flies with white eyes instead of eyes

570 – 560 million years ago

700–600 million years ago

Early multicellular eukaryotes

Ancestors of many present-day plants and animals

Cambrian Explosion

2 billion years ago

First single-cell eukaryotes

0 100 ␮m 200 0 300 ␮m 600

Primaevifilum amoenum, an

early prokaryote

3.7 billion years ago

Figure 1.11 Two-winged and four-winged flies Geneticists

converted a contemporary normal two-winged fly to a

four-winged insect resembling the fly’s evolutionary antecedent They

accomplished this by mutating a key element in the fly’s

regula-tory network Note the club-shaped halteres behind the wings of

the fly at the top.

of the normal red color One can thus conclude that the

pro-tein product of this gene plays a key role in the

develop-ment of eye pigdevelop-mentation From their study of model

organisms, researchers are amassing a detailed picture of

the complexity of living systems

However, even though the power of genetic techniques isastonishing, the complexity of biological systems is difficult

to comprehend We have seen that the human organism

car-ries 20,000–30,000 genes and that each human being arises

from the networks of interactions created by these genes and

the proteins they encode Knowing everything there is to

know about each of these genes and proteins would not,

how-ever, reveal how a human results from a particular ensemble

of genes and proteins For example, the human nervous

sys-tem is a network of 1011neurons with perhaps 1018

connec-tions The complexity of the system is far too great to be

encoded by a simple correspondence between genes and

neu-rons or genes and connections Moreover, the remarkable

properties of the system, such as learning, memory, and

per-sonality, do not arise solely from the genes and proteins;

net-work interactions and the environment also play a role The

goal of understanding higher-order processes that arise from

interacting networks of genes, proteins, cells, and organs is

one of the most challenging aspects of modern biology

Ge-netics provides useful tools for tackling this challenge, but the

concepts and information needed to achieve this

understand-ing are as yet unknown

The new global tools of genomics—such as throughput DNA sequencers, genotypers, and large-scale

high-DNA arrays (also called high-DNA chips)—have the capacity

to analyze thousands of genes rapidly and accurately

These global tools are not specific to a particular system

or organism; rather, they can be used to study the genes of

all living things

The DNA chip is a powerful example of a global nomic tool Individual chips are subdivided into arrays of

ge-microscopic blocks that each contain a unique string of

DNA units (Fig 1.13a) When a chip is exposed to a

com-plex mixture of fluorescently labeled nucleic acid—such

as DNA or RNA from any cell type or sample—the

unique string in each microscopic block can bind to and

detect a specific complementary sequence This type of

binding is known as hybridization (Fig 1.13b) A

com-puter-driven microscope can then analyze the bound quences of the hundreds of thousands of blocks on thechip, and special software can enter this information into

se-a dse-atse-abse-ase (Fig 1.13c).

The potential of DNA chips is enormous for both search and clinical purposes Already chips with over400,000 different detectors can provide simultaneous infor-mation on the presence or absence of 400,000 discrete DNA

re-or RNA sequences in a complex sample And they can do itwithin hours Here is one example Now that the sequence ofall human genes is known, unique stretches of DNA repre-senting each of the 20,000–30,000 human genes can beplaced on a chip and used to determine the complete set ofgenes copied into RNA in any human cell type at any stage ofdevelopment or differentiation Computer-driven compar-isons can be used to contrast the genes expressed (that iscopied to RNA for translation to protein) in different celltypes, for example, in neurons and muscle cells, making itpossible to determine which genes of the human genomecontribute to the construction of various cell types Scientistshave already created catalogues of the genes expressed in dif-ferent cell types and have discovered that some genes, called

“housekeeping genes,” are expressed in nearly all cell types,while other genes are expressed only in certain specializedcells This knowledge of the relation between particulargenes and particular cell types is helping us understand howthe cellular specialization necessary for the construction of allhuman organs arises

In medicine, clinical researchers have used DNA chiptechnology to identify genes whose expression increases ordecreases when tumor cells are treated with an experimentalcancer drug (Fig 1.13b-c) Changes in the patterns of geneexpression may provide clues to the mechanisms by whichthe drug might inhibit tumor growth In a related but slightlydifferent application of the same idea, researchers can assessthe inherent differences between breast cancers that respondwell to a particular drug therapy and those that do not (that is,that recur despite treatment) Knowledge of these patientssince microarray analysis of their tumors can predict withconsiderable accuracy whether a specific drug will be effec-tive against their particular type of cancer

1.6 Genetic Techniques Permit the Dissection of Complexity 9

Figure 1.12 Five model organisms whose genomes were sequenced as part of the Human Genome Project The chart

indicates genome size in millions of base pairs, or megabases (Mb) It also shows the approximate number of genes for each organism.

1.7 Our Focus Is on

Human Genetics

In the mid-1990s, a majority of scientists who responded to a

survey conducted by Science magazine rated genetics as the

most important field of science for the next decade One

reason is that the powerful tools of genetics open up the sibility of understanding biology, including human biology,from the molecular level up to the level of the whole organ-ism In combination with an appreciation of the relatedness ofall living organisms, the potential of genetic analysis heralds

pos-an era that promises to help reveal more about who we are.The Human Genome Project, by changing the way weview biology and genetics, has led to a significant paradigm

10 Chapter 1 Genetics: The Study of Biological Information

Figure 1.13 One use of a DNA chip (a) Schematic drawing of the components of a DNA chip (b) 1 Preparing complementary DNA,

or cDNA, with a fluorescent tag from the RNA of a group of cells 2 The hybridization of chip DNA to fluorescent cDNA from untreated

and drug-treated cells (c) Computerized analysis of chip hybridizations makes it possible to compare gene activity in any two types of cells.

The cDNA represents genes that are active, that is, being converted to protein via RNA.

Gene that strongly increased

activity in treated cells

Gene that strongly decreased

activity in treated cells

Gene that was equally active

in treated and untreated cells

Gene that was inactive

in both groups

cDNA from untreated cells

2.

1.

Pair of complementary bases

chip DNA cDNA

T C C T G C A

A G G A C G T

C C C G G A T

G G G A C T A

T T A A G C G

A A T T C G C

T T A A G C G

A A T T C G C

cDNA from treated cells

Part of one DNA strand

DNA bases

The detection of DNA-cDNA hybridization.

Computer analysis of the binding of complementary

sequences can identify genes that respond to drug

treatment.

A G G A C G T

change: the systems approach to biology and medicine.

The systems approach seeks to study the relationships of

all the elements in a biological system as it undergoes

ge-netic perturbation or biological activation (see Chapter 12)

This is a fundamental change from the study of complex

systems one gene or protein at a time

How Human Genetics Is Leading Us Toward

Predictive and Preventive Medicine

Over the next 25 years, geneticists will identify hundreds of

genes with variations that predispose people to many types of

disease: cardiovascular, cancerous, immunological, mental,

metabolic Some mutations will always cause disease; others

will only predispose to disease For example, a change in a

specific single DNA base (that is, a change in one DNA unit)

in the ß-globin gene will nearly always cause sickle-cell

ane-mia, a painful, life-threatening condition that leads to severe

anemia By contrast, a mutation in the breast cancer 1

(BRCA1) gene has only a 70% chance of causing breast

can-cer in a woman carrying one copy of the mutation; this

con-ditional state arises because the BRCA1 gene interacts with

environmental factors that affect the probability of activating

the cancerous condition and because various forms of other

genes modify expression of the BRCA1 gene Defining and

analyzing the multiple factors contributing to genetic

predis-positions may be an important element in understanding and

designing therapies for some diseases Physicians may be

able to use DNA diagnostics—a collection of techniques for

characterizing genes—to analyze an individual’s DNA for

genes that predispose to some diseases With this genetic

pro-file, they may be able to write out a probabilistic health

his-tory for some medical conditions Many people will benefit

from genetically based diagnoses and forecasts This will

move us into the era of predictive medicine

As scientists come to understand the complex systems inwhich disease genes operate, they may be able to design ther-

apeutic drugs to block and/or reverse the effects of mutant

genes If taken before the onset of disease, such drugs could

prevent occurrence or minimize symptoms of the gene-based

disease This will usher in the era of preventive medicine

Al-though the discussion here has focused on genetic conditions

rather than infectious diseases, it is possible that ongoing

analyses of microbial and human genomes will lead to

proce-dures for controlling the virulence of some pathogens

The New Scope of Human Genetics and the

New Potential of Predictive and Preventive

Medicine Intensify the Need to Confront

Many Social Issues

Genetics began as a separate biological discipline dedicated

to determining the rules governing the frequency of

appear-ance of alternative traits in siblings and other related

individuals At the beginning of the twenty-first century, it hasbecome the central focus and tool in the study of complex bi-ological systems created by the interactions of molecular en-tities Although biological information is similar to othertypes of information from a strictly technical point of view, it

is as different as can be in its meaning and impact on ual human beings and human society as a whole The differ-ence lies in the personal nature of the unique genetic profilecarried by each person from birth Within this basic level ofbiological information are complex life codes that providegreater or lower susceptibility or resistance to many diseases,

individ-as well individ-as greater or lesser potential for the expression ofmany physiologic, physical, and neurological attributes thatdistinguish people from each other Until now, almost all thisinformation has remained hidden away But if research con-tinues at its present pace, in less than a decade it will becomepossible to read a large part of a person’s genetic profile, andwith this information will come the power to make some lim-ited predictions about future possibilities and risks

As we will see in many of the Genetics and Society boxesthroughout this book, society can use genetic information notonly to help people but also to restrict their lives (for example,

by denying insurance or employment) We believe that just asour society respects an individual’s right to privacy in otherrealms, it should also respect the privacy of an individual’s ge-netic profile and work against all types of discrimination.Another issue raised by the potential for detailed ge-netic profiles is the interpretation or misinterpretation ofthat information Without accurate interpretation, the infor-mation becomes useless at best and harmful at worst.Proper interpretation of genetic information requires someunderstanding of statistical concepts such as risk and prob-ability To help people understand these concepts, wide-spread education in this area will be essential Since themedia play an enormous role in the lives of most people,public education could begin with media reports on newgenetic findings that are well reasoned and accurate It willalso be essential to bring kindergarten through high-schooleducation up-to-date so that children can learn the conceptsand implications of modern human biology as a science ofinformation

Yet another pressing issue concerns the regulation andcontrol of the new technology With the sequencing of theentire human genome, government funds appropriated forthe sequencing project can be redirected toward analyzinggenetic variation among humans as well as various aspects

of genome structure and organization The question ofwhether the government should establish guidelines for theuse of genetic and genomic information, reflecting soci-ety’s social and ethical values, remains in open debate

To many people, the most frightening potential of thenew genetics is the development of technology that can

alter or add to the genes present within the germ line

(reproductive cell precursors) of human embryos Thistechnology (referred to as “transgenic technology” inscientific discourse and “genetic engineering” in public

1.7 Our Focus Is on Human Genetics 11

discussions) has become routine in hundreds of

laborato-ries working with various animals other than humans

Some people caution that developing the power to

al-ter our own genomes is a step we should not take, arguing

that if genetic information and technology are misused (as

they certainly have been in the past), the consequences

could be horrific Attempts to use genetic information for

social purposes were prevalent in the early twentieth

cen-tury, leading to enforced sterilization of individuals

thought to be inferior, to laws that prohibited interracial

marriage, and to laws prohibiting immigration of certain

ethnic groups The scientific basis of these actions has

been thoroughly discredited Others agree that we must

not repeat the mistakes of the past, but warn that if the new

technologies could help children and adults lead healthier,

happier lives, we need to think very carefully about

whether the reasons for objecting outright to their use are

valid Most agree that the biological revolution we are ing through will have a greater impact on human societythan any technological revolution of the past and that edu-cation and public debate are the key to preparing for theconsequences of this revolution

liv-The focus on human genetics in this book looks ward into the new era of biology and genetic analysis As

for-we gain increasingly sophisticated knowledge about thehuman genetic makeup, it will not only become possible

to cure human diseases that now resist therapy; it willalso become possible to have an impact on our own evo-lution (through, for example, germ-line alterations) Wehave seen that these new possibilities raise serious moraland ethical issues that will demand wisdom and humility

It is in the hope of educating young people for the moraland ethical challenges awaiting the next generation that

we write this book

12 Chapter 1 Genetics: The Study of Biological Information

Connections

Genetics, the study of biological information, is also the

study of the DNA and RNA molecules that store, replicate,

transmit, and evolve information for the construction of

proteins With their extraordinary diversity of structure and

function, proteins generate the complex and adaptive

be-haviors of all living organisms At the molecular level, all

living things are closely related As a result, observations of

model organisms as different as yeast and mice can provide

insights into general biological principles as well as human

biology

Remarkably, more than 75 years before the discovery

of DNA, Gregor Mendel, an Augustinian monk working in

medicine

what is now Brno in the Czech Republic, delineated the sic laws of gene transmission with no knowledge of themolecular basis of heredity He accomplished this by fol-lowing simple traits, such as flower or seed color, that come

ba-in two discrete forms, such as white and purple or yellowand green, through several generations He used the pea

plant (Pisum sativum) as his experimental organism and set

up carefully controlled matings between plants thatdiffered in one or a few traits We now know that his find-ings apply to all sexually reproducing organisms Chapter 2describes Mendel’s studies and insights, which became thefoundation of the field of genetics

Annotated Suggested Readings

and Links to Other Websites

On Our Website

www.mhhe.com/hartwell3

Chapter 1

PART I Basic Principles: How Traits Are Transmitted

A quick glance at an extended family portrait is likely

to reveal children who resemble one parent or the other

or who look like a combination of the two, with

per-haps wavy hair from the father, a broad nose from the

mother, and a skin color in between the two parents’

(Fig 2.1) Some children, however, look unlike any of

the assembled relatives and more like a throwback to a

great, great grandparent What causes the similarities

and differences of appearance and the skipping of

generations?

The answers lie in our genes, the basic units of logical information, and in heredity, the way genes

bio-transmit biochemical, anatomical, and behavioral traits

from parents to offspring Each of us starts out as a

single fertilized egg cell that develops, by division and

(a hundred trillion) specialized cells, including muscle

cells capable of contraction, brain cells structured for

rapid communication, red blood cells tailored for

trans-porting oxygen, and hair cells that carry pigment for

black, brown, blond, or flaming red hair By current

estimates, only about 25,000 genes control this amazing developmental process

Passed from parents to offspring through egg and sperm, these genes underlie the

formation of every heritable trait Such traits are as diverse as the shape of your

hairline, the tendency to bald as you age, the timbre of your voice, the way you

clasp your hands, even your susceptibility to heart disease and certain cancers

And they all run in families in predictable patterns that impose some

possibili-ties and exclude others

Genetics, the science of heredity, pursues a precise explanation of the

bio-logical structures and mechanisms that determine inheritance Geneticists seek to

identify genes, to learn how they determine particular traits, and to understand how

genes work together to create a person, a plant, or a protozoan In some instances,

the relationship between gene and trait is remarkably simple A change in a

sin-gle gene, for example, results in sickle-cell anemia by causing construction of a

defective hemoglobin molecule, the oxygen-carrying protein in red blood cells;

when oxygen is in short supply, red blood cells carrying the abnormal

hemoglo-bin become sickle-shaped and clog small blood vessels In other instances, the

cor-relations between genes and traits are bewilderingly complex An example is the

genetic basis of facial features, in which many genes determine a large number of

molecules that interact in a variety of ways to generate the combination we

rec-ognize as a friend’s face

Gregor Mendel (1822–1884; Fig 2.2), a stocky, bespectacled Augustinian

monk and expert plant breeder, discovered the basic principles of genetics in the

mid–nineteenth century He published his findings in 1866, just seven years after

Although Mendel’s laws can predict the probability that an individual will have a particular genetic makeup, the chance meeting of particular male and female gametes determines an individual’s actual genetic fate.

Darwin’s On the Origin of Species appeared in print Mendel lived

and worked in Brunn, Austria (now Brno in the Czech Republic), anineteenth-century center of learning in the sciences and humanities,situated in the rich agricultural valley of the province of Moravia.Here he examined the inheritance of such clear-cut alternative traits

in pea plants as purple versus white flowers or yellow versus greenseeds In so doing, he discovered why some of these traits disap-peared in one generation and then reappeared in another By rigor-ously analyzing the patterns of transmission through generations, heinferred genetic laws that allowed him to make verifiable predictionsabout which traits would appear, disappear, and then reappear inwhich generations Simple and straightforward, Mendel’s laws arebased on the hypothesis that observable traits such as seed color aredetermined by independent units of inheritance not visible to the naked

eye We now call these units genes The concept of the gene

contin-ues to change as research deepens and refines our understanding of genetic ena Today, a gene is recognized as a region of DNA that encodes a specific protein

phenom-or a particular type of RNA In the beginning, however, it was an abstraction—animagined particle with no physical features, whose function was to control a visibletrait—that Mendel proposed as the explanation for the results of his plant breedingexperiments

We begin our study of genetics with a detailed look at what Mendel’s laws areand how they were discovered In subsequent chapters, we discuss logical exten-sions to these laws and describe how Mendel’s successors grounded the abstractconcept of hereditary units (genes) in an actual biological molecule (DNA) Today,geneticists integrate the analytical tools of Mendel with modern molecular tech-niques as they continue to probe the nature of the hereditary material and exam-ine exactly how it is passed from parent to offspring, how it acts in organisms toproduce the visible and invisible traits that define individuals, and how it evolvesover time

Four general themes emerge from our detailed discussion of Mendel’s work.The first is that variation, as expressed in alternative forms of a trait (a high-pitched voice or a low one, a green pea or a yellow one), is widespread in nature

This genetic diversity provides the raw material for the continuouslyevolving variety of life we see around us Second, observable varia-tion is essential for following genes If all the traits of all offspringresembled their parents’, Mendel would have had no basis for dis-cerning and analyzing patterns of transmission Third, variation is notdistributed solely by chance; rather, it is inherited according to geneticlaws that explain why like begets both like and unlike Dogs begetother dogs; pea plants beget pea plants; and people, people But thereare hundreds of breeds of dogs, and even within a breed—Labradorretrievers, for instance—two black dogs could have a litter of black,

brown, and golden puppies (Fig 2.3) Mendel’s insights help explain

why this is so Fourth, the laws Mendel discovered about heredityapply equally well to all sexually reproducing organisms, from proto-zoans to peas to people

Our presentation of Mendelian genetics examines

• The background: The historical puzzle of inheritance and how Mendel’sinnovative experimental approach helped resolve it

• The work itself: Genetic analysis according to Mendel, including a cussion of Mendel’s seminal experiments and analytical tools

dis-• The medical significance: Two comprehensive examples of Mendelianinheritance in humans

14 Chapter 2 Mendel’s Breakthrough: Patterns, Particles, and Principles of Heredity

Figure 2.3 Like begets like and unlike A

Labrador retriever with her litter of pups.

Figure 2.1 A family portrait The extended

fam-ily shown here includes members of four generations.

Figure 2.2 Gregor Mendel.

Photographed around 1862

holding one of his experimental

plants His work formed the

basis for our understanding and

continued exploration of the

science of genetics.

2.1 Background: The Historical

Puzzle of Inheritance

There are several steps to understanding genetic

phenom-ena: the careful observation over time of groups of

organ-isms, such as human families, herds of cattle, or fields of

corn or tomatoes; the rigorous analysis of systematically

recorded information gleaned from these observations; and

the development of a theoretical framework that can

ex-plain the origin of these phenomena and their relationships

In the mid–nineteenth century, Gregor Mendel became the

first person to combine the three approaches and reveal the

true basis of heredity For many thousands of years before

that, the elementary selective breeding of domesticated

plants and animals, with no guarantee of what a particular

mating would produce, was the only genetic practice

Artificial Selection Was the First

Applied Genetic Technique

A rudimentary use of genetics was the driving force behind

a key transition in human civilization, allowing hunters and

gatherers to settle in villages and survive as shepherds and

farmers Even before recorded history, people practiced

ap-plied genetics as they domesticated plants and animals for

their own uses From a large litter of semitamed wolves, for

example, they sent the savage and the misbehaving to the

stew pot while sparing the alert sentries and friendly

com-panions for longer life and eventual mating As a result of

this artificial selection—purposeful control over mating

by choice of parents for the next generation—the domestic

dog (Canis domesticus) slowly arose from ancestral wolves

(Canis lupus) The oldest bones identified indisputably as

dog (and not wolf ) are a skull excavated from a

20,000-year-old Alaskan settlement Many millennia of evolution

guided by artificial selection have produced massive Great

Danes and minuscule Chihuahuas as well as hundreds of

other modern breeds of dog The amazing range of size,

shape, and behavior bears witness to the enormous amount

of genetic variation in ancient canines and the degree of

differentiation that artificial selection can produce By

10,000 years ago, people had used this same kind of

ge-netic manipulation to develop economically valuable herds

of reindeer, sheep, goats, pigs, and cattle that produced

life-sustaining meat, hides, and wools

Farmers also carried out artificial selection of plants,storing seed from the healthiest and tastiest individuals for

the next planting, eventually producing strains that grew

better, produced more, and were easier to cultivate and

har-vest In this way, scrawny weedlike plants gradually, with

human guidance, turned into rice, wheat, barley, lentils,

and dates in Asia; corn, squash, tomatoes, potatoes, and

peppers in North and South America; yams, peanuts,

and gourds in Africa Later, plant breeders recognized maleand female organs in plants and carried out artificial polli-nation An Assyrian frieze carved in the ninth century B.C.,

pictured in Fig 2.4, is the oldest known visual record of

this kind of genetic experiment It depicts priests brushingthe flowers of female date palms with selected male pollen

By this method of artificial selection, early practical neticists produced several hundred varieties of dates, eachdiffering in specific observable qualities, such as the fruit’ssize, color, or taste A 1929 botanical survey of three oases

ge-in Egypt turned up 400 varieties of date-bearge-ing palms,twentieth-century evidence of the natural and artificiallygenerated variation among these trees

The Puzzle of Passing on Desirable Traits

In 1822, the year of Mendel’s birth, what people inMoravia understood about the basic principles of hereditywas not much different from what the people of ancientAssyria had understood By the nineteenth century, plantand animal breeders had created many strains in which off-spring often carried a prized parental trait Using suchstrains, they could produce plants or animals with desiredcharacteristics for food and fiber, but they could not alwayspredict why a valued trait would sometimes disappear andthen reappear in only some offspring For example, selec-tive breeding practices had resulted in valuable flocks of

2.1 Background: The Historical Puzzle of Inheritance 15

Figure 2.4 The earliest known record of applied genetics.

In this 2800-year-old Assyrian relief from the Northwest Palace

of Assurnasirpal II (883–859 B C ), priests wearing bird masks artificially pollinate flowers of female date palms.