1. Trang chủ
  2. » Nông - Lâm - Ngư

Ứng dụng phản ứng PCR trực tiếp (Direct PCR) phát hiện một số vi khuẩn ở gà mắc bệnh hô hấp phức hợp tại Hà Nội và vùng phụ cận

10 5 0

Đang tải... (xem toàn văn)

THÔNG TIN TÀI LIỆU

Thông tin cơ bản

Định dạng
Số trang 10
Dung lượng 10,63 MB

Các công cụ chuyển đổi và chỉnh sửa cho tài liệu này

Nội dung

Nghiên cứu này thiết lập và ứng dụng phản ứng PCR trực tiếp (direct PCR) để xác định tần suất có mặt của một số vi khuẩn thường gặp ở gà mắc bệnh hô hấp phức hợp. Kết quả chỉ ra rằng mức độ đồng thuận của phương pháp PCR trực tiếp so với PCR thường quy là rất cao.

Trang 1

Cao Thị Bích Phượng*, Nguyễn Văn Giáp, Nguyễn Thành Trung, Mai Thị Ngân, Vũ Thị Ngọc, Huỳnh Thị Mỹ Lệ

Khoa Thú y, Học viện Nông nghiệp Việt Nam

*Tác giả liên hệ: ctbphuong@vnua.edu.vn

TÓM TẮT

Bệnh hô hấp phức hợp đã nổi lên như một thách thức kinh tế lớn đối với ngành chăn nuôi gia cầm Cùng với

đó, các công cụ chẩn đoán hiện tại như các quy trình xét nghiệm nuôi cấy phân lập vi khuẩn, huyết thanh học hay PCR thường quy tốn nhiều thời gian & sử dụng nhiều công lao động Chính vì vậy, nghiên cứu này thiết lập và ứng dụng phản ứng PCR trực tiếp (direct PCR) để xác định tần suất có mặt của một số vi khuẩn thường gặp ở gà mắc bệnh hô hấp phức hợp Kết quả chỉ ra rằng mức độ đồng thuận của phương pháp PCR trực tiếp so với PCR thường quy là rất cao Khi kiểm tra 173 gà mắc hội chứng sưng phù đầu nghi do các mầm bệnh như Mycoplasma gallisepticum (MG), Avibacterium paragallinarum (APG), Ornithobacterium rhinotracheale (ORT) và avian pathogenic Escherichia coli (APEC) bằng phản ứng PCR trực tiếp, 68% trường hợp dương tính với ít nhất một mầm bệnh khảo sát, trong khi 23% gà bị nhiễm đồng thời 2-3 mầm bệnh Như vậy, phương pháp PCR trực tiếp có thể được sử dụng như một công cụ hiệu quả để phát hiện một số vi khuẩn ở gà mắc bệnh hô hấp phức hợp ở Hà Nội và vùng phụ cận

Từ khóa: PCR trực tiếp, bệnh hô hấp phức hợp, vi khuẩn, gia cầm, Hà Nội

Application of Direct PCR for Detection of Several Bacteria in Chicken

with Respiratory Disease Complex in Hanoi and Neighbour Vicinity

ABSTRACT

The respiratory disease complex has emerged as a major economic problem for the poultry industry In addition, the current diagnostic tools, such as bacteria isolation, serological tests, and conventional PCR are time-consuming and labor-intensive Therefore, this study was carried out to develop the direct PCR and to apply it to investigate the presence of some common bacteria in the swollen head syndrome Compared with the conventional PCR results, the Kappa value for direct PCR was almost in perfect agreement Among 173 samples screening by direct PCR, 68% of cases revealed infection by at least one investigated pathogen, while 23% had concurrent infections by two to three bacteria in a single case As a result, direct PCR is recommended to be an effective tool for detecting the concurrent infections by Mycoplasma gallisepticum (MG), Avibacterium paragallinarum (APG), Ornithobacterium rhinotracheale (ORT) and avian pathogenic Escherichia coli (APEC) of the swollen head syndrome in chickens in the vicinity of Hanoi Keywords: Direct PCR, complex respiratory disease, bacteria, co-infection, poultry, Hanoi

Trang 2

Trang 3

µ

µ

µ µ µ

Mồi xuôi

/mồi ngược Trình tự (5’-3’) Chu trình nhiệt phản ứng PCR thường quy MG.732F GGATCCCATCTCGACCACGAGAAAA 1 vòng (94C - 4 phút)

40 vòng (94C - 20 giây, 55C - 40 giây, 72C - 60 giây)

1 vòng (72C - 5 phút) /MG.732R CTTTCAATCAGTGAGTAACTGATGA

APG.500F CAATGTCGATCCTGGTACAATGAG 1 vòng (94C - 4 phút)

40 vòng (94C - 20 giây, 60C - 30 giây, 72C - 40 giây)

1 vòng (72C - 5 phút) /APG.500R CAAGGTATCGATCGTCTCTCTACT

ORT.784F GAGAATTAATTTACGGATTAAG 1 vòng (94C - 4 phút)

40 vòng (94C - 20 giây, 52C - 30 giây, 72C - 60 giây)

1 vòng (72C - 5 phút) /ORT.784R TTCGCTTGGTCTCCGAAGAT

APEC.553F AATCCGGCAAAGAGACGAACCGCCT 1 vòng (94C - 4 phút)

40 vòng (94C - 20 giây, 60C - 40 giây, 72C - 40 giây)

1 vòng (72C - 5 phút)

/APEC.553R GTTCGGGCAACCCCTGCTTTGACTTT

APEC.496F TCATCCCGGAAGCCTCCCTCACTACTAT

/APEC.496R TAGCGTTTGCTGCACTGGCTTCTGATAC

APEC.450F GGCCACAGTCGTTTAGGGTGCTTACC

/APEC.450R GGCGGTTTAGGCATTCCGATACTCAG

APEC.323F CAGCAACCCGAACCACTTGATG

/APEC.323R AGCATTGCCAGAGCGGCAGAA

APEC.302F GGCTGGACATCATGGGAACTGG

/APEC.302R CGTCGGGAACGGGTAGAATCG

Trang 4

µ

µ

Trang 5

µ

Trang 6

PCR thường quy

Trang 7

TT Mầm bệnh Số mẫu Tỉ lệ (%)

Trang 8

Altman D.G & Bland J.M (1994) Statistics Notes: Diagnostic tests 1: sensitivity and specificity BMJ 308(6943): 1552

Rautenschlein,S (2008) Reproducibility of swollen sinuses in broilers by experimental infection with avian metapneumovirus subtypes A and B of turkey origin and their comparative pathogenesis, Avian Pathol 37(1): 65-74

Alshahni M.M., Makimura K., Yamada T., Satoh K., Ishihara Y., Takatori K & Sawada T (2009) Direct colony PCR of several medically important fungi using Ampdirect plus, Jpn J Infect Dis 62(2): 164-7

Andreopoulou M., Franzo G., Tucciarone C.M., Prentza Z., Koutoulis K.C., Cecchinato M & Chaligianni I (2019) Molecular epidemiology of infectious bronchitis virus and avian metapneumovirus in Greece, Poult Sci 98(11): 5374-5384

Ben-Amar A., Oueslati S & Mliki A (2017) Universal direct PCR amplification system: a time- and cost-effective tool for high-throughput applications 3 Biotech 7(4): 246-246

Chen X., Miflin J.K., Zhang P & Blackall P.J (1996) Development and application of DNA probes and PCR tests for Haemophilus paragallinarum, Avian Dis 40(2): 398-407

Cascella R., Strafella C., Ragazzo M., Zampatti S., Borgiani P., Gambardella S., Pirazzoli A., Novelli

G & Giardina E (2015) Direct PCR: a new pharmacogenetic approach for the inexpensive testing of HLA-B*57:01 Pharmacogenomics J 15(2): 196-200

Trang 9

David L Suarez, Sjaak de Wit, Tom Grimes,

Deirdre Johnson, Michelle Kromm, Teguh

Yodiantara Prajitno, Ian Rubinoff & Guillermo

Zavala (2020) Diseases of poultry (14th) John

Wiley & Sons, Inc., Hoboken, NJ 07030, USA

De Boeck C., Kalmar I., Dumont A & Vanrompay D

(2015) Longitudinal monitoring for respiratory

pathogens in broiler chickens reveals co-infection of

rhinotracheale J Med Microbiol 64(Pt 5): 565-574

De Oliveira A.L., Rocha D.A., Finkler F., De Moraes

L.B., Barbieri N.L., Pavanelo D.B., Winkler C.,

Grassotti T.T., De Brito K.C., De Brito B.G &

Horn F (2015) Prevalence of ColV

plasmid-linked genes and in vivo pathogenicity of avian

strains of Escherichia coli, Foodborne Pathog Dis

12(8): 679-85

Đào Thị Hảo (2008) Phân lập, xác định một số đặc

tính sinh học của Mycoplasma gallisepticum & chế

kháng nguyên, huyết thanh chẩn đoán Luận án

Tiến sĩ Nông nghiệp Viện Thú y

Eszik I., Lantos I., Önder K., Somogyvári F., Burián

K., Endrész V & Virok D.P (2016) High

dynamic range detection of Chlamydia trachomatis

growth by direct quantitative PCR of the infected

cells, J Microbiol Methods 120: 15-22

Feuerman M & Miller A.R (2008) Relationships

between statistical measures of agreement:

sensitivity, specificity and kappa, J Eval Clin Pract

14(5): 930-3

Goodwin M.A & Waltman W.D (1994) Clinical and

pathological findings in young Georgia broiler

chickens with oculofacial respiratory disease

("so-called swollen heads"), Avian Dis 38(2): 376-8

García M., Ikuta N., Levisohn S & Kleven S.H

(2005) Evaluation and comparison of various PCR

gallisepticum infection in chickens Avian

Diseases 49(1): 125-132

Gharaibeh S.M & Algharaibeh G.R (2007)

Serological and molecular detection of avian

pneumovirus in chickens with respiratory disease

in Jordan, Poult Sci 86(8): 1677-81

Johnson T.J., Wannemuehler Y., Doetkott C., Johnson

S.J., Rosenberger S.C & Nolan L.K (2008)

Identification of minimal predictors of avian

pathogenic Escherichia coli virulence for use as a

rapid diagnostic tool J Clin Microbiol

46(12): 3987-96

amplification in the presence of phenol Biotechniques 16(1): 84-92

Kwon J.S., Lee H.J., Jeong S.H., Park J.Y., Hong Y.H., Lee Y.J., Youn H.S., Lee D.W., Do S.H., Park S.Y., Choi I.S., Lee J.B & Song C.S (2010)

metapneumovirus from chickens in Korea J Vet Sci 11(1): 59-66

Kaore M., Singh K., Palanivelu M., Asok Kumar M., Reddy M & Kurkure N.V (2018) Patho-epidemiology of respiratory disease complex pathogens (RDPs) in commercial chicken Indian J Vet Pathol 42(4): 231-238

Lorenz T.C (2012) Polymerase chain reaction: basic protocol plus troubleshooting and optimization strategies Journal of visualized experiments: JoVE (63): e3998-e3998

Lê Văn Hùng, Nguyễn Thị Giang & Trần Danh Sơn (2019) Phân lập, xác định đặc điểm của vi khuẩn gây bệnh sổ mũi truyền nhiễm trên gà tại một số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nông nghiệp Việt Nam 17(8): 622-629

Mcdougall J.S & Cook J.K (1986) Turkey rhinotracheitis: preliminary investigations Vet Rec 118(8): 206-7

Mohamed M Shawki Lebdah M.A., Shahin A.M & Nassif S A (2017) Some studies on swollen head syndrome in broiler chickens in Egypt, Zagazig Veterinary Journal 45(S1): 132-141

Nakamura K., Mase M., Tanimura N., Yamaguchi S & Yuasa N (1998) Attempts to reproduce swollen head syndrome in specific pathogen-free chickens

by inoculating with Escherichia coli and/or turkey rhinotracheitis virus Avian Pathol 27(1): 21-7 Nguyễn Thị Lan, Chu Đức Thắng, Nguyễn Bá Hiên, Phạm Hồng Ngân, Lê Văn Hùng & Nguyễn Thị Yến (2016) Đặc điểm của vi khuẩn Ornithobacterium rhinotracheale (ORT) phân lập

từ đàn gà nuôi tại một số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nông nghiệp Việt Nam 14(11): 1734-1740

Nguyễn Thị Loan, Lê Đình Quyền, Dương Hồng Quân,

Lê Huỳnh Thanh Phương, Nguyễn Bá Hiên & Lê Văn Phan (2016) Ứng dụng kỹ thuật RT-PCR để chẩn đoán bệnh viêm phế quản truyền nhiễm (Infectious bronchitis) ở gà đẻ trứng tại một số tỉnh phía Bắc Việt Nam Tạp chí Khoa học Nông nghiệp Việt Nam 14(9): 1387-1394

Paudel S., Hess M & Hess C (2017) Coinfection of

Trang 10

Roussan D.A., Haddad R & Khawaldeh G (2008)

Molecular survey of avian respiratory pathogens in

commercial broiler chicken flocks with respiratory

diseases in Jordan Poult Sci 87(3): 444-8

Samy A & Naguib M.M (2018) Avian respiratory

coinfection and impact on avian influenza

pathogenicity in domestic poultry: field and

experimental findings Vet Sci 5(1): 23

Tanaka M., Takuma H., Kokumai N., Oishi E., Obi T.,

Hiramatsu K & Shimizu Y (1995) Turkey

Rhinotracheitis Virus Isolated from Broiler Chicken

with Swollen Head Syndrome in Japan Journal of

Veterinary Medical Science 57(5): 939-941

Trương Hà Thái, Nguyễn Ngọc Đức, Nguyễn Văn Giáp

& Chu Thị Thanh Hương (2009) Xác định tỉ lệ

nhiễm Mycoplasma gallisepticum ở 2 giống gà

hướng thịt Ross 308 & ISA màu nuôi công nghiệp

tại một số tỉnh miền Bắc Việt Nam Tạp chí Khoa

học & Phát triển 7(3): 306-313

Ornithobacterium rhinotracheale: A review Avian

Pathol 28(3): 217-27

Orninobacterium rhinotracheale ở gà Tạp chí Khoa học Kỹ thuật Thú y 21(7): 23-27

Wilfinger W.W., Mackey K & Chomczynski P (1997) Effect of pH and ionic strength on the spectrophotometric assessment of nucleic acid purity Biotechniques 22(3): 474-6, 478-81

Yu M., Xing L., Chang F., Bao Y., Wang S., He X., Wang J., Wang S., Liu Y., Farooque M., Pan Q., Wang Y., Gao L., Qi X., Hussain A., Li K., Liu C., Zhang Y., Cui H., Wang X & Gao Y (2019) Genomic sequence and pathogenicity of the first avian metapneumovirus subtype B isolated from chicken in China Vet Microbiol 228: 32-38 Zhong C., Gopinath S., Norona W., Ge J., Lagacé R.E., Wang D.Y., Short M.L & Mulero J.J (2019) Developmental validation of the Huaxia™ Platinum PCR amplification kit: A 6-dye multiplex direct amplification assay designed for Chinese reference samples Forensic Science International: Genetics 42: 190-197

Ngày đăng: 12/02/2022, 10:11

TỪ KHÓA LIÊN QUAN

TÀI LIỆU CÙNG NGƯỜI DÙNG

TÀI LIỆU LIÊN QUAN

🧩 Sản phẩm bạn có thể quan tâm