Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

Exergoeconomic optimization and improvement of a cogeneration system modeled in a process simulator using direct search and evolutionary methods

... Mechanical Engineering at UFRJ. He is a member of the Brazilian Society of Mechanical Sciences an d Engineering (ABCM) and of the American Institute of Aeronautics and Astronautics (AIAA). E-mail ... with a pointful appraisal of the mathematical optimization and exergoeconomic improvement of energy systems modeled in a professional thermodynamic process si...

Ngày tải lên: 05/09/2013, 16:30

14 596 0
Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

Tài liệu Báo cáo khoa học: Identification and characterization of the transcription factors involved in T-cell development, t-bet, stat6 and foxp3, within the zebrafish, Danio rerio docx

... 5¢-RACE Zf5¢stat6-R2 GGACTGACATTGCTCCAGAGC 5¢-RACE Zf3¢stat6-F3 GCTTCAGTGACTCAGAAATTGG 3¢-RACE Zf3¢stat6-F4 GTCCAGAATATTCAGCCTTTCACC 3¢-RACE Zftbet-F1 CTCCCTCAAACAAACCAGAGTC Initial PCR Zftbet-R1 CACTGGATGAGACAGGAAGTT ... GGAAACTTCCTGTCTCATCCAGTG 5¢-RACE Zffoxp3-F1 GGAACACACAGAGGGGATGATA Initial PCR Zffoxp3-R1 CTTCAACACGCACAAAGCAC Initial PCR Zffoxp3-F2 TGCCACCTTTTCCATCATACA Initial PCR Zffox...

Ngày tải lên: 16/02/2014, 09:20

20 691 0
Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

Báo cáo khoa học: A novel pathway for sequential transformation of 7-dehydrocholesterol and expression of the P450scc system in mammalian skin pptx

... detected in control placenta, whole human skin, normal epidermal and immor- talized keratinocytes, dermal fibroblasts, squamous cell carcinoma and five human melanomas. Thus, these data clarify in detail ... plate w ith chloroform/methanol (1 : 1, v/v ), and the associated radioactivity measured by scintillation counting. Side-chain cleavage of 7-DHC by placental and adrenal mitoc...

Ngày tải lên: 23/03/2014, 13:20

11 478 0
Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

Báo cáo y học: " Safety and efficacy of undenatured type II collagen in the treatment of osteoarthritis of the knee: a clinical trial"

... in treating osteoarthritis (OA). The present clinical trial evaluated the safety and efficacy of UC-II as compared to a combination of glucosamine and chondroitin (G+C) in the treatment of OA ... significant changes in serum chemistry (creatinine, blood urea nitrogen, alanine aminotransferase, and aspartate aminotransferase) were noted. Following UC-II withdrawal for a p...

Ngày tải lên: 26/10/2012, 09:48

10 709 0
Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

Spatial moment analysis of colloid facilitated radionuclide transport in a coupled fracture-matrix system

... Department of Civil Engineering, Indian Institute of Technology – Madras, Chennai 36, India. 2 Department of Ocean Engineering, Indian Institute of Technology – Madras, Chennai-36, India. Abstract ... migration significantly since they are smaller than the intergranular pores and fractures in rock and have the capacity to travel long distances in percolating waters [19]. Many...

Ngày tải lên: 05/09/2013, 17:03

14 479 0
Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

Tài liệu Báo cáo khoa học: Expression and secretion of interleukin-1b, tumour necrosis factor-a and interleukin-10 by hypoxia- and serum-deprivation-stimulated mesenchymal stem cells Implications for their paracrine roles ppt

... cardiac fibrosis in a paracrine manner under ischaemic conditions. Taken together, these findings may improve understanding of the cellu- lar and molecular basis of the anti -in ammatory and paracrine ... China Introduction Ischaemic heart disease is a life-threatening condition that may cause sudden cardiac failure and death. Many researchers have investigated cell transplantat...

Ngày tải lên: 18/02/2014, 04:20

11 653 0
Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

Tài liệu Báo cáo khoa học: Cloning and characterization of CBL-CIPK signalling components from a legume (Pisum sativum) ppt

... reverse) 55¢-CCATCACAAGAAACTAGAGAAAC-3 PsCIPK (5¢UTR forward) 65¢-TTAAGTACTATAAAT-ACACAGCCTA-3¢ PsCIPK (3¢UTR reverse) 75¢-CGAGCTCACTGCCTCTCAAC-3¢ PsCBL (5¢UTR forward) 85¢-ACTCGTAGC-ACAGAGACAGAG-3¢ PsCBL ... AAR01663) and AtCBL3 (AAM91280). The calcium binding domains (EF1–4) and calcineurin A binding domain are shown in the box. The dot in the EF1 box repre- sents the modified amin...

Ngày tải lên: 19/02/2014, 07:20

19 709 0
Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

Tài liệu Báo cáo khoa học: "Integration of Large-Scale Linguistic Resources in a Natural Language Understanding System" pdf

... parsing, semantic analysis, and pragmatic analysis. Each stage has been designed to use linguistic data such as the lexicon and grammar, which are maintained separately from the engine, and ... resources into our natural language understanding system. Client- server architecture was used to make a large volume of lexical information and a large knowledge base available...

Ngày tải lên: 20/02/2014, 18:20

5 421 0
Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

Tài liệu Báo cáo Y học: Presence and regulation of the endocannabinoid system in human dendritic cells potx

... 1. MATERIALS AND METHODS Materials and animals Deuterated anandamide, PalEtn and 2-AG were synthe- sized from [ 2 H 4 ]palmitic acid and [ 2 H 8 ]arachidonic acid and ethanolamine or glycerol as ... 20-fold higher than those of anandamide. In fact, after LPS-induced maturation, the amounts of 2-AG were increased 2.8-fold, as in the mouse macrophage J774 cell line [24] and...

Ngày tải lên: 22/02/2014, 07:20

8 647 0
w