. et al: A Rapid Method for 22 Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monitoring and. in large scale inspection for workplaces. Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of
Ngày tải lên: 05/09/2013, 13:23
... Proceedings of the 43rd Annual Meeting of the ACL, pages 605–613, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms ... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fa...
Ngày tải lên: 08/03/2014, 04:22
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢. The PCR solution was prepared ... and using the following primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CAC...
Ngày tải lên: 18/02/2014, 13:20
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf
... LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for ... Calmanovici RW, Martin-Padura I, Breviario F, Garlanda C, Ramponi S, Mantovani A & Vecchi A (1997) A general strategy for isolation of endothelial cells from murine tissues. Charact...
Ngày tải lên: 18/02/2014, 17:20
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx
... anti- sense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; anti- sense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG TCTC-3¢) ... 5¢-CAATACTGTCT TTCTGGCCTTC-3¢, and that of s-DNA is 5¢-ATAGGCG GGAATTTTGCATC-3¢. Anti-TMV siRNA was synthe- sized using the DNA templates 5¢-AAGGGACGAGCA TATGTACACCCTGTCTC-3¢ and 5¢-A...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Kinetic hybrid models composed of mechanistic and simplified enzymatic rate laws – a promising method for speeding up the kinetic modelling of complex metabolic networks pptx
... The load charac- teristics were calculated by varying a load parameter within a preset range of physiologically reasonable values. For each value of the load parameter, the steady state was computed ... consumption rate appears at a 3.3-fold increased value of k ATPase as compared to the value k 0 ATPase ¼ 1:6h À1 . At values of k ATPase exceeding seven-fold of its normal va...
Ngày tải lên: 23/03/2014, 06:20
USAID Supported a Wide Range of Child and Maternal Health Activities, but Lacked Detailed Spending Data and a Proven Method for Sharing Best Practices pptx
... Global Health Bureau for Africa Bureau for Asia and the Near East Bureau for Latin America and the Caribbean Chief Financial Officer 9 missions Responsible for policy and program coordination across ... 40 The State Department’s Office of Foreign Assistance defines an element as a broad category of program under a particular program area. For example, “Maternal and Child...
Ngày tải lên: 28/03/2014, 09:20
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... is the Bhattacharyya coefficient, we can de- rive an analytical form that allows efficient calculation. For the task of word similar- ity estimation using a large amount of Web data in Japanese, ... Kuroda Masaki Murata † Kentaro Torisawa Language Infrastructure Group, MASTAR Project National Institute of Information and Communications Technology (NICT) 3-5 Hikaridai, Seika-cho, Sorak...
Ngày tải lên: 30/03/2014, 21:20
Conventional Providing a Uniform Law for Bill of exchange and Promissory Notes
Ngày tải lên: 22/10/2013, 10:15