Graphs of Polynomial Functions

LOCAL POLYNOMIAL CONVEXITY OF GRAPHS OF FUNCTIONS IN SEVERAL VARIABLES

LOCAL POLYNOMIAL CONVEXITY OF GRAPHS OF FUNCTIONS IN SEVERAL VARIABLES

... Chi, Local polynomial convexity of certain graphs in C2 , Michigan Math J 58 (2), 479-488 (2009) [7] Nguyen Quang Dieu, Local polynomial convexity of tangentials union of totally real graphs in ... (X)) then P (X) = C(X) Local polynomial convexity of graphs in Cn Now we come to the main results of this work Theorem 3.1 Let U be a open neighborhood of...

Ngày tải lên: 14/10/2015, 08:00

15 275 0
Báo cáo toán học: "Recognizing circulant graphs of prime order in polynomial time" doc

Báo cáo toán học: "Recognizing circulant graphs of prime order in polynomial time" doc

... set W of indices write AW for the submatrix of A consisting of all rows and columns index with elements of W It is easy to see by inspection that each of the blocks Adj(A)γi (a) is of one of the ... the case of a prime number n of vertices, i.e we shall propose a still somewhat complicated, but nevertheless time -polynomial, method for recognizing arbitrary circulant gr...

Ngày tải lên: 07/08/2014, 06:22

28 279 0
Báo cáo toán học: "Recognizing circulant graphs in polynomial time: An application of association schemes" pot

Báo cáo toán học: "Recognizing circulant graphs in polynomial time: An application of association schemes" pot

... electronic journal of combinatorics (2001), #R26 the investigation to certain subclasses of circulants It is in this context that S-ring theory becomes useful Subclasses of circulants can be characterized ... idea of working with the interplay between association schemes and S-rings has been successfully employed in [21] for the case of circulants on a prime number of vertic...

Ngày tải lên: 07/08/2014, 06:22

32 347 0
Báo cáo toán học: "A multivariate interlace polynomial and its computation for graphs of bounded clique-width" docx

Báo cáo toán học: "A multivariate interlace polynomial and its computation for graphs of bounded clique-width" docx

... computations of bounded portions of the interlace polynomials for graphs in classes of bounded tree-width and more generally of bounded clique-width The proof uses descriptions of interlace polynomials ... the bounds for the interlace polynomial C and its specializations Theorem 23 is actually a corollary of Theorem 31 Proof of Theorem 23: For each k,...

Ngày tải lên: 07/08/2014, 21:20

36 257 0
Báo cáo toán học: "Evaluating a Weighted Graph Polynomial for Graphs of Bounded Tree-Width" potx

Báo cáo toán học: "Evaluating a Weighted Graph Polynomial for Graphs of Bounded Tree-Width" potx

... algebra and weighted graphs Advances in Soviet Mathematics, 21:135–145, 1994 [12] J Edmonds Systems of distinct representatives and linear algebra Journal of Research of the National Bureau of Standards ... Many well-studied classes of graphs have bounded tree-width: for instance, seriesparallel networks are the graphs with tree-width at most two A large class of gr...

Ngày tải lên: 07/08/2014, 21:21

14 235 0
Representation of nonnegative Morse polynomial functions and applications in Polynomial Optimization

Representation of nonnegative Morse polynomial functions and applications in Polynomial Optimization

... KG , each lying in the interior of KG Then f ∈ TG Proof The proof follows from Theorem and Theorem Applications in polynomial Optimization 4.1 Unconstrained polynomial Optimization In this section ... vectors in Zn of the form λw, λ > Denote by F(Γ ) the family of primitive vectors supporting some face of Γ of dimension n − Representation of Morse polynomi...

Ngày tải lên: 14/10/2015, 08:30

15 318 0
Tài liệu Reserve Bank of India: Functions and Working doc

Tài liệu Reserve Bank of India: Functions and Working doc

... Reserve Bank of India: Functions and Working ž¸¸£·¸ú¡¸ ¹£ö¸¨¸Ä ¤¸ÿˆ RESERVE BANK OF INDIA www.rbi.org.in Foreword The Reserve Bank of India, the nation’s central bank, began operations ... Publications by the Reserve Bank 112 Annex – List of Abbreviations 114 Index on Boxes S No Name of the Box Item Origins of the Reserve Bank of India Functions...

Ngày tải lên: 16/02/2014, 10:20

122 485 0
Đề tài " Norm preserving extensions of holomorphic functions from subvarieties of the bidisk " potx

Đề tài " Norm preserving extensions of holomorphic functions from subvarieties of the bidisk " potx

... Annals of Mathematics, 157 (2003), 289–312 Norm preserving extensions of holomorphic functions from subvarieties of the bidisk By Jim Agler and John E McCarthy* Introduction A basic result in the theory ... proof in an appendix at the end of the paper 295 HOLOMORPHIC FUNCTIONS The equivalence of the von Neumann inequality and the extension property...

Ngày tải lên: 05/03/2014, 23:20

25 278 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
Doctor of Philosophy in Mathematics Linear and Non-linear Operators, and The Distribution of Zeros of Entire Functions

Doctor of Philosophy in Mathematics Linear and Non-linear Operators, and The Distribution of Zeros of Entire Functions

... order of the sum of two functions is not greater than the larger of the orders of the two summands, and if the orders of the summands and of the sum are all equal, then 21 the type of the sum ... all the zeros of g(z) lie in (−1, 0), then the zeros of h(z) also lie in K (iii) If the zeros of f (z) lie in (−a, a) and the zeros...

Ngày tải lên: 10/03/2014, 16:15

104 496 0
Đề tài " On the homology of algebras of Whitney functions over subanalytic sets " doc

Đề tài " On the homology of algebras of Whitney functions over subanalytic sets " doc

... Localization techniques Peetre-like theorems Hochschild homology of Whitney functions Hochschild cohomology of Whitney functions Cyclic homology of Whitney functions Whitney- de Rham cohomology of subanalytic ... subanalytic subsets, one calls the triangulation T compatible with the Xj , if every one of the sets Xj is a union of simplices h(Δ), THE...

Ngày tải lên: 22/03/2014, 20:21

53 389 0
Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

... processing for the tasks of document summarization (Lin and Bilmes, 2010) and word alignment (Lin and Bilmes, 2011) Submodular functions share a number of properties in common with convex and concave functions ... monotone submodular function yields a submodular function, and summing them all together retains submodularity, as mentioned in Section The monotonicity of R(S)...

Ngày tải lên: 23/03/2014, 16:20

11 440 0
Báo cáo khoa học: " Determination of Syntactic Functions in Estonian Constraint Grammar " docx

Báo cáo khoa học: " Determination of Syntactic Functions in Estonian Constraint Grammar " docx

... Fred Karlsson 1990 Constraint Grammar as a framework for parsing running text Proceedings of COLING-90 Vol 3, 168-173, Helsinki Tiina Puolakainen 1998 Developing Constraint Grammar for Morphological ... supervision of trustee.' Conclusions In this paper I described my work on the syntactic part of Estonian Constraint Grammar parser The error rate of parser is 1-4% de...

Ngày tải lên: 24/03/2014, 03:21

2 248 0
Đề tài " Uniform expansion bounds for Cayley graphs of SL2(Fp) " pptx

Đề tài " Uniform expansion bounds for Cayley graphs of SL2(Fp) " pptx

... Annals of Mathematics, 167 (2008), 625–642 Uniform expansion bounds for Cayley graphs of SL2(Fp) By Jean Bourgain and Alex Gamburd* Abstract We prove that Cayley graphs of SL2 (Fp ) are ... UNIFORM EXPANSION BOUNDS FOR CAYLEY GRAPHS OF SL2 (Fp ) 627 Our second result shows that random Cayley graphs of SL2 (Fp ) are expanders (Given a group G, a rand...

Ngày tải lên: 29/03/2014, 07:20

19 189 0
w