New bioactive biomaterials based on quaternized chitosan

Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

... 100 words in section 23 using model (3) For 'no lexical information' all estimates are based on POS tags alone For 'no distance measure' the distance measure is Question alone (i.e whether zbj ... backed-off estimation strategy is used for making prepositional phrase attachment decisions The idea is to back-off to estimates based on less context In this case, less context means look...

Ngày tải lên: 08/03/2014, 07:20

8 324 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

10 454 0
Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance...

Ngày tải lên: 26/10/2012, 09:07

11 660 0
Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

Báo cáo khoa học: A new clan of CBM families based on bioinformatics of starch-binding domains from families CBM20 and CBM21 potx

... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase amy_Aspaw a- amylase CBM2 0...

Ngày tải lên: 07/03/2014, 21:20

17 477 0
Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

Báo cáo khoa học: "Introduction of a new paraphrase generation tool based on Monte-Carlo sampling" potx

... SMT Language model and paraphrase table Paraphrase generation tools based on SMT methods need a language model and a paraphrase table Both are computed on a training corpus The language models ... propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm is the sam...

Ngày tải lên: 17/03/2014, 02:20

4 340 0
báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx

báo cáo hóa học: " A new definition of burnout syndrome based on Farber''''s proposal" pptx

... information contained in each of the selected units was compared and a common conceptual denomination was assigned to the group of segments sharing the same clinical profile as a standard As a next ... of the organizational model of signification is noted and its form of production by means of a typology of elemental relations" These relations are: contradiction, contrar...

Ngày tải lên: 20/06/2014, 00:20

17 606 0
Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx

Báo cáo hóa học: "Research Article ISAR Imaging of Ship Target with Complex Motion Based on New Approach of Parameters Estimation for Polynomial Phase Signal" docx

... 1: Parameters of the simulated signal Components (k) Ak ak,1 ak,2 ak,3 π/8 × 10−3 × 10−5 1.5 π/4 −1 × 10−3 −6 × 10−5 ISAR Imaging of Ship Target Based on IHMPT The ISAR imaging algorithm of ship ... multicomponent CPS for ISAR imaging of ship target with high maneuverability In this paper, a new algorithm called IHMPT is proposed to estimate the para...

Ngày tải lên: 21/06/2014, 05:20

9 413 0
Báo cáo hóa học: " Research Article Fast Signal Recovery in the Presence of Mutual Coupling Based on New 2-D Direct Data Domain Approach" pdf

Báo cáo hóa học: " Research Article Fast Signal Recovery in the Presence of Mutual Coupling Based on New 2-D Direct Data Domain Approach" pdf

... was proposed for the fast recovery of the signal with one snapshot of receiving signals in the presence of mutual coupling, based on 2D D3 LS algorithm for URA Then, utilizing the 2-D D3 LS algorithm ... of the coupling coefficients versus the SNR Conclusion In this paper, the problems of 2-D D3 LS algorithms were studied for recovering of the...

Ngày tải lên: 21/06/2014, 05:20

9 419 0
Báo cáo hóa học: " Research Article A New User Dependent Iris Recognition System Based on an Area Preserving Pointwise Level Set Segmentation Approach" docx

Báo cáo hóa học: " Research Article A New User Dependent Iris Recognition System Based on an Area Preserving Pointwise Level Set Segmentation Approach" docx

... used all samples of three famous iris databases, that is, CASIA-IrisV3, Bath, and Ubiris CASIA-IrisV3 includes three subsets which are labeled as CASIA-IrisV3-Interval, CASIA-IrisV3-Lamp, and CASIA-IrisV3-Twins ... USA, September-August 2006 [7] L Ma, T Tan, Y Wang, and D Zhang, “Personal identification based on iris texture analysis,” IEEE Transactions on Pattern Analysis and Machin...

Ngày tải lên: 21/06/2014, 22:20

13 296 0
Báo cáo hóa học: " Research Article A New OFDMA Scheduler for Delay-Sensitive Traffic Based on Hopfield Neural Networks" doc

Báo cáo hóa học: " Research Article A New OFDMA Scheduler for Delay-Sensitive Traffic Based on Hopfield Neural Networks" doc

... modulation (ACM) Then, in this paper, we focus on a subcarrier allocation strategy that is aware of the queuing state per each user and that retains a fixed power allocation as well as adaptive quadrature ... quadrature amplitude modulation (QAM) Subcarrier allocation in OFDMA can be seen as a combinational problem where there are plenty of possible combinations associated to a giv...

Ngày tải lên: 22/06/2014, 00:20

9 299 0
Báo cáo hóa học: " Research Article New Approaches for Channel Prediction Based on Sinusoidal Modeling" pdf

Báo cáo hóa học: " Research Article New Approaches for Channel Prediction Based on Sinusoidal Modeling" pdf

... Viberg, “Two new approaches for channel prediction based on sinusoidal modeling,” EURASIP Journal on Applied Signal Processing, special issue on advances in subspace -based techniques for signal ... performance of the sinusoidal modelingbased channel prediction methods depends heavily on the stationarity properties of model parameters in the observation window a...

Ngày tải lên: 22/06/2014, 23:20

13 268 0
Báo cáo hóa học: "A New Repeating Color Watermarking Scheme Based on Human Visual Model" doc

Báo cáo hóa học: "A New Repeating Color Watermarking Scheme Based on Human Visual Model" doc

... 16 CONCLUSIONS Combining the theory of the visual secret sharing scheme and the viewpoint of the human visual model, this paper proposes a new watermarking scheme to embedding the digital color ... “A digital watermarking scheme using human visual effects,” Informatica, vol 24, no 4, pp 505–511, 2000 [5] C.-C Chang and H C Wu, “A copyright protection scheme of images...

Ngày tải lên: 23/06/2014, 01:20

8 239 0
Báo cáo sinh học: " A new view on dam lines in Polish Arabian horses based on mtDNA analysis" doc

Báo cáo sinh học: " A new view on dam lines in Polish Arabian horses based on mtDNA analysis" doc

... Origin of Polish Arabian horses 613 614 I G a ewska et al z Eight haplotypes were each represented in a single dam line All Babolna’s dam lines, Szamrajówka, Selma, and two of four of Sławuta’s ... G a ewska et al z Table I Dam lines in Arabian horses in Poland: founders and main branches of the lines * In brackets: percentage of representatives of the line of b...

Ngày tải lên: 14/08/2014, 13:22

11 272 0
Báo cáo y học: "iBsu1103: a new genome-scale metabolic model of Bacillus subtilis based on SEED annotations." pdf

Báo cáo y học: "iBsu1103: a new genome-scale metabolic model of Bacillus subtilis based on SEED annotations." pdf

... Morimoto T, Kadoya R, Endo K, Tohata M, Sawada K, Liu S, Ozawa T, Kodama T, Kakeshita H, Kageyama Y, Manabe K, Kanaya S, Ara K, Ozaki K, Ogasawara N: Enhanced recombinant protein productivity by genome ... reaction data (Table S2 in Additional data files and 2), estimated thermodynamic data (Table S2 in Additional data files and 2), model stoichiometry in SBML format (Additional data file...

Ngày tải lên: 14/08/2014, 21:20

15 306 0
w