... CONTENTS 5. 1 Sequences 5. 2 Series 5. 3 The Integral and Comparison Test 5. 4 Other Convergence Test 5. 5 Power Series 5. 6 Representations of Functions as Power Series 5. 7 Taylor and Maclaurin Series 5. 8 ... Binomial Series 5. 9 Applications of Taylor Polynomial 5. 10 Using Series to solve Differential Equations 5. 11 Fourier Series 5. 2 SERIES 5. 2.1 Th...
Ngày tải lên: 06/12/2015, 16:41
... Fluorescence studies of RepA R E M Diederix et al Interestingly, in the latter case, the protein binds as a monomer [26] Free in solution, the protein is essentially dimeric, ... DNA-binding domains, and rearrangement of the relative orientation of the two domains [7,9] The conformational change upon iteron binding may expose a recognition site for prote...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... corresponding to the introns of the two genes The fragments were sequenced and enabled the complete reconstruction of the Psy1 and Psy2 genes with the annotation of introns and exons The GenBank ... based on the lack of information regarding the 5¢-region in the Psy2 DNA sequence and from the conflicting evidence available in the database records of t...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx
... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...
Ngày tải lên: 17/03/2014, 03:20
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... platinum, but not nuclease hypersensitive elements of human c-myc and PDGF-A promoters; the abundance of unfolded DNA is proportional to the platinum concentration Results CD spectrum of G-rich oligonucleotides ... my student Lubos Bauer and Professor Viktor Brabec for the opportunity to work in his laboratory and obtain skills with respect to DNA platination...
Ngày tải lên: 23/03/2014, 06:20
SCOP: A Structural Classification of Proteins Database for the Investigation of Sequences and Structures ppt
... unit of classification is usually the protein domain Small proteins, and most of those of medium size, have a single domain and are, therefore, treated as a whole The domains in large proteins are ... database and the headers of Brookhaven Protein Databank structure files To provide easy and broad access, we have made the scop database available as a set...
Ngày tải lên: 23/03/2014, 12:20
Query Languages and Data Models for Database Sequences and Data Streams doc
... Istream, Dstream and Rstream are not considered in this paper) Nonblocking Query Operators We can now formalize the notion of sequences as a bridge between database relations and streams Sequences consist ... formal analysis of how query languages and also data models are impacted by these changes, to propose practical solutions for the resulting problems We studied...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo hóa học: " Research Article A Study of Residue Correlation within Protein Sequences and Its Application to Sequence Classification" pptx
... our study, we used two different alphabets: a set of 20 amino acids residues, A , and a hydropathy-based alphabet, ΣH , derived from grammar complexity and syntactic structure of protein sequences ... MIV j (A) and MIVk (B), can be concatenated to form MIV j+k (C) ANALYSIS OF CORRELATION IN PROTEIN SEQUENCES In [1], Weiss states that protein sequences can be re...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo hóa học: "EXTENDING GENERALIZED FIBONACCI SEQUENCES AND THEIR BINET-TYPE FORMULA" pot
... Rachidi, and O Saeki, Approximation of ∞ -generalized Fibonacci sequences and their asymptotic Binet formula, The Fibonacci Quarterly 39 (2001), no 2, 168– 180 , On periodic ∞ -generalized Fibonacci sequences, ... Miles Jr., Generalized Fibonacci numbers and associated matrices, The American Mathematical Monthly 67 (1960), no 8, 745–752 [7] W Motta, M Rachidi, and O S...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " Multipattern Consensus Regions in Multiple Aligned Protein Sequences and Their Segmentation" pot
... evaluating consensus regions in multiple aligned protein sequences This paper presents an outline of the segmentation algorithm (see Yan [10]) for multipattern consensus regions in aligned protein sequences, ... overlapping regions Gap exists between some regions The result shows that the positions of the p53 sequences form clear regions There are D -regions...
Ngày tải lên: 22/06/2014, 22:20
Parallel and Series Connections pptx
... operator Conclusions Series and parallel connections are an important aspect of battery system design and operation, and affect areas as diverse as safety, reliability, and maintenance With this ... voltage of the parallel- connected units remains the same, and the overall capacity is the sum of the capacities of the parallel units Unlike series connections it is not re...
Ngày tải lên: 06/07/2014, 22:20
Báo cáo toán học: "Stapled Sequences and Stapling Coverings of Natural Numbers" doc
... the problem of covering finite sequences of natural numbers by arithmetic progressions with prime differences The concept of efficiency of such coverings is introduced in this paper and constructions ... fact, as shown below, stapling coverings exist for all N ≥ 17 Efficient Stapling Coverings An interesting characteristic of stapling covering is the ratio of the numbe...
Ngày tải lên: 07/08/2014, 06:20
Báo cáo toán học: "Tournament Sequences and Meeussen Sequences" pot
... trees, and therefore a unique bijection between tournament sequences and Meeussen sequences which respects the ideas of extending or truncating a sequence To better understand Meeussen sequences, ... Wouter Meeussen [private communication, 1999], and we here name sequences with this property Meeussen sequences in his honor Part of their definition is similar to that of s...
Ngày tải lên: 07/08/2014, 06:20
Báo cáo toán học: "A note on major sequences and external activity in trees" pdf
... We denote by i(T ) the number of inversions of T We also denote by In+ 1 (k) the set of trees on {0, , n} with k inversions and define the inversion enumerator for trees on {0, , n} as In+ 1 ... Stanley for encouraging us to work on this problem, and for providing us with valuable references References [1] J S Beissinger On external activity and inversions in trees J Comb...
Ngày tải lên: 07/08/2014, 06:22