eWork and ebusiness in architecture engineering and construction

Tài liệu Báo cáo " Study on reuse of heavy metal rich sludge in ceramic pigment and construction material production " docx

Tài liệu Báo cáo " Study on reuse of heavy metal rich sludge in ceramic pigment and construction material production " docx

... absorption were analyzed/tested in the laboratory of Construction material, Hanoi University of Construction The environmental safety of sludge re-usage was assessed based on heavy metals leaching ... ratio origin material (%) In further study, heavy metal leaching into rain water with lower pH value and longer soaking time should be investigated; the use of mi...

Ngày tải lên: 12/02/2014, 17:20

7 439 0
Tài liệu Báo cáo "Proper orthogonal decomposition and recent advanced topics in wind engineering" pptx

Tài liệu Báo cáo "Proper orthogonal decomposition and recent advanced topics in wind engineering" pptx

... with emphasis on recent advanced topics in the wind engineering: (1) Analyzing, identifying and reconstructing the random surface pressure fields around some typical rectangular cylinders, moreover, ... in structural dynamics and wind engineering, Wind & Structures, 3, (2000) 221 [16] Chen, X., Kareem, A., Proper orthogonal decomposition- based modeling, analysis, and...

Ngày tải lên: 13/02/2014, 03:20

18 531 0
Terminology and symbols in control engineering

Terminology and symbols in control engineering

... 00/03 device-related solution in a simple and clear manner Fundamentals ⋅ Terminology and Symbols in Control Engineering Terminology in Control Engineering To maintain a physical quantity, such ... schulung@samson.de Internet: http://www.samson.de Part ⋅ L101 EN Terminology and Symbols in Control Engineering Introduction Terminology in Control Engin...

Ngày tải lên: 29/03/2014, 21:55

28 399 0
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot

... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGT...

Ngày tải lên: 30/03/2014, 13:20

10 696 0
biotreatment downstream processing and modelling advances in biochemical engineering

biotreatment downstream processing and modelling advances in biochemical engineering

... reviewed here within an engineering context Advancesin Biochemical Engineering Biotechnology, Vol 56 Managing Editor: Th Scheper Springer-VerlagBerlin Heidelberg 1997 Pratima Bajpai and Pramod K Bajpai ... of lignin in the alkaline pulping liquor The lignin reactions involved in kraft pulping have been studied extensively [3~6] About 90% of the lignin is removed, the 10% or so rem...

Ngày tải lên: 01/04/2014, 10:20

208 319 0
w