Bài soạn Ba 1 - Phap luat va doi song (a2)
... Số hiệu Ngày ký Người ký Trích yếu Cơ quan ban hành Phần loại Hiệu lực 68/ LCT/HĐNN8 18 /04/92 Võ Chí Công Hiến pháp năm 19 92 Quốc hội Hiến pháp CƠ QUAN BAN HÀNH Quốc hội Pháp lệnh, Nghị Chủ tịch ... phát huy vai trò công cụ chủ yếu để Nhà nước quản lý xã hội nhà nước phải tổ chức ba khâu: Xây dựng pháp luật thực pháp luật bảo vệ pháp luật Theo em pháp luật có vai trò công dân? Vai trò...
Ngày tải lên: 22/11/2013, 20:11
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20