... GTGATTCATGGTGGAAATACGCCCCCATCAGGGGGCTGG TTTTGCGGCCGCGCCAGCCCCCTGATGGGGGCGCAGCCTCCAGGA CCCCCCCTCCCGGGAGAGCCATAGTGGTCTGCGGAACCGGTTTT AAAAACCGGTTCCGCAGACCACTATGGCTCTCCCGGGAGGGGGGG TCCTGGAGGCTGCGCCCCCATCAGGGGGCTGGCGCGGCCGCAAAA ... GCCAGCCCCCTGATGGGGGCGA TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT GCCAGACACTCCACCATGAATCACTCCCCTGTGAGGAACTACTGTCTTCACG TAATACGACTCACTATAGGGTGCACGGTCTACGAGACCT TTTGCGGCCGCG...
Ngày tải lên: 20/02/2014, 01:20
... Virology Journal 2 010 , 7 :18 1 http://www.virologyj.com/content/7 /1/ 1 81 Page of 11 Analysis of recombinant AmCPV S1 and S3 encoded proteins expressed in E coli and insect cells AmCPV S1 and S3 were ... microscopy, structural basis of capsid stability and mRNA processing regulation Structure 20 03, 11 :6 51- 6 63 17 Yu X, Jin L, Zhou ZH: 3. 88A° structure of cyt...
Ngày tải lên: 12/08/2014, 04:20
Grade 7-1st semester-test 1
... join d joining a office b agency c station d hall 10 a bore b bored c boring d to bore VI Make the complete sentences from the words given: (5) 41 How long / take / you / / homework? ... later, Shirley works in the center of London in a police (9) ………………… “I enjoy my work I’m never (10 ) ………………… I meet a lot of people every day, and my job changes all the time.” a in b by c with ... Arch...
Ngày tải lên: 09/06/2015, 20:00
Grade 7-2nd semester-test 1
... ĐÁP ÁN I (điểm) Mỗi câu 0.5đ 1. C 5B 2.A 6.C II 3.5 (điểm) Mỗi câu 0.5đ A (2đ) 1. popular 2.spreads 5.Over can 3.A 7.B 3.pair 4.small many 4.A 8.A 8.strongest B (1. 5đ) People need only a pair,
Ngày tải lên: 09/06/2015, 21:00
Tài liệu Báo cáo khoa học: Functional hierarchy of plasminogen kringles 1 and 4 in fibrinolysis and plasmin-induced cell detachment and apoptosis docx
... (19 88) The cellbinding domains of plasminogen and their function in plasma J Biol Chem 263, 11 928 11 9 34 24 Thewes T, Constantine K, Byeon IJ & Llinas M (19 90) Ligand interactions with the kringle ... rate of plasmin formation in the absence of mAbs Plasmin-induced cell detachment and apoptosis are impaired by selectively blocking the LBS of plasminogen K1 o...
Ngày tải lên: 20/02/2014, 01:20
Tài liệu Báo cáo Y học: Binding of gelsolin domain 2 to actin An actin interface distinct from that of gelsolin domain 1 and from ADF/cofilin pptx
... of actin as evidenced by cross-linking experiments (sequence 11 4 22 5) Two peptides belonging both to the 11 4 22 5 sequence and exposed regions of subdomain were tested (1 12 – 12 5 and 11 9 – 1 32 ... Kd of 2. 9 mM The binding of the 11 9 1 32 peptide was confirmed in solution To perform such an experiment gelsolin 15 9 19 3 fragment was labelled with FI...
Ngày tải lên: 22/02/2014, 07:20
Báo cáo Y học: Structural and serological relatedness of the O-antigens of Proteus penneri 1 and 4 from a novel Proteus serogroup O72 pptx
... and 2.06 Therefore, the polysaccharide has a tetrasaccharide repeating unit containing one residue each of D-Glc and D-Gal and two D-residues of GalNAc The 1H- and 13 C NMR spectra of the polysaccharide ... Assignment of the major series in the 1H and 13 C NMR spectra of the O-deacetylated polysaccharide using 2D COSY and 1H, 13 C HMQC experiments (Table...
Ngày tải lên: 17/03/2014, 17:20
Báo cáo khoa học: Inhibitors of protein phosphatase 1 and 2A decrease the level of tubulin carboxypeptidase activity associated with microtubules pptx
... treated with lM OA for h, and then with 10 lM taxol for 10 Cytoskeletons were isolated and incubated for the stated times to determine the amount of tubulin carboxypeptidase activity associated with ... Exposure of cells to OA induces redistribution of tubulin carboxypeptidase activity between the microtubuleassociated and nonassociated states The sca...
Ngày tải lên: 23/03/2014, 15:21
báo cáo hóa học:" Gene and microRNA analysis of neutrophils from patients with polycythemia vera and essential thrombocytosis: down-regulation of micro RNA-1 and -133a" pot
... [32] Figure Gene expression analysis of MPD neutrophils Gene expression analysis of MPD neutrophils Gene expression of neutrophils from MPD patients, healthy subject neutrophils and healthy subjects ... the molecular basis of MPDs, we compared gene and miRNA expression profiles of neutrophils from MPD patients with those from healthy subjects We...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: " Superparamagnetic iron oxide nanoparticle attachment on array of micro test tubes and microbeakers formed on p-type silicon substrate for biosensor applications" pdf
... first part of this work, we report fabrication of arrays of micro test tubes and microbeakers formed on p-type Si substrate with varying pore and particle sizes For the micro test tubes, the ... the micro test tubes and microbeakers on p-Si and analyses of the results SEM imaging was performed by AJ and MR SOR and ADG concentrated on the...
Ngày tải lên: 20/06/2014, 22:20
Transcript of Speech Test-1 pot
... make As some of you may know, Chuck Adams, the maintenance worker of this building for the last 25 years, is leaving us at the end of the month As he’s been here longer than any of us and done ... amount of time? Then you must order the new Iron-man Springblade! This easy-to-assemble piece of exercise equipment can be adjusted quickly and easily and can be used to strengthen every...
Ngày tải lên: 29/06/2014, 14:20
UNIT 3-WAYS OF SOCIALISING-Test 3
... important in Japan 35 the / rank / of / the / bow / person / the / facing / you / lower / the / you / higher a The higher the rank of the person facing you, the lower you bow b The rank of the person ... the non-verbal conventions of that language- the meaning of a shrug, a pout, or a smile Speech thus often includes not only a face-to-face meeting, but also a meeting of the mind...
Ngày tải lên: 01/07/2014, 19:00
Ôn Tập 11 CB (Unit 3 - 2 Tests & Final Test 1)
... A 36 D 46 D C 17 C 27 D 37 C 47 A A 18 A 28 A 38 D 48 B C 19 A 29 A 39 A 49 C ÔN TẬP 11 BAN CƠ BẢN (2) ~ TEST (From Unit 1 -3 ) D 11 A 21 C 31 C 41 B B 12 D 22 B 32 B 42 D A 13 D 23 D 33 B 43 A ... 28 B 38 B 48 A A 19 D 29 C 39 C 49 C 10 A 20 B 30 C 40 A 50 D PRACTEST 2 C 11 B 21 A 31 B 41 C D 12 C 22 B 32 C 42 A C 13 D 23 C 33 C 43 B A 14 A 24 D...
Ngày tải lên: 12/07/2014, 18:00
English Language Proficiency Tests-Advanced Level''''sarchiveAt the End of the Day (1) ppt
... journey to slumber land or the land of nod Differently Alternately Adversely Alternatively 9.and parents of a musical of mind can speed their children on their way to this land of sleep with a lullaby ... of bed first thing, long time ages periods lengths 3.but whatever the required , all of us need sleep at some time during the day or night sum total amount lot 4.And so i...
Ngày tải lên: 25/07/2014, 07:20