Hepatitis c and transfusion a lookback primer

Báo cáo y học: "Successful outcome of a pregnancy in a woman with advanced cirrhosis due to hepatitis B surface antigenemia, delta super-infection and hepatitis C co-infection: a case report" pdf

Báo cáo y học: "Successful outcome of a pregnancy in a woman with advanced cirrhosis due to hepatitis B surface antigenemia, delta super-infection and hepatitis C co-infection: a case report" pdf

... resolution of < /b> these issues on a < /b> case by case basis With < /b> careful monitoring and advanced < /b> management, successful pregnancy < /b> with < /b> a < /b> good outcome < /b> is a < /b> good possibility The excellent outcome < /b> of < /b> the pregnancy < /b> ... evidence, such as the presence of < /b> esophageal varices, abdominal collateral veins, hypersplen...

Ngày tải lên: 11/08/2014, 10:23

3 292 0
Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc

Báo cáo y học: "Development and management of systemic lupus erythematosus in an HIV-infected man with hepatitis C and B co-infection following interferon therapy: a case report" doc

... http://jmedicalcasereports.com/jmedicalcasereports/article/view/7289 tomography; MRI, magnetic resonance imaging; ANCA, antineutrophil cytoplasmic antibodies; ANA, antinuclear antibody; dsDNA, double-stranded DNA; SLE, systemic < /b> lupus < /b> erythematosus;< /b> ... Submit your case report today • Rapid peer review • Fast publication • PubMed indexing • Inclusion in < /b> Cases Datab...

Ngày tải lên: 11/08/2014, 17:21

5 625 0
Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc

Báo cáo y học: "Prediction of prognostic biomarkers for Interferon-based therapy to Hepatitis C Virus patients: a metaanalysis of the NS5A protein in subtypes 1a, 1b, and 3a" doc

... databases Associative classification aims to discover a small set of rules in the database, called class association rules, to form an accurate classifier The accuracy of the rules is measured by their ... Street, Cairo, Egypt, 2Science and Technology Research Centre, American University in Cairo, Cairo, Egypt, 3Biology Department, American University in Cairo, Cairo,...

Ngày tải lên: 12/08/2014, 04:20

9 213 0
Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

Báo cáo khoa học: Halogenated benzimidazoles and benzotriazoles as inhibitors of the NTPase/helicase activities of hepatitis C and related viruses ppt

... ATGGCGCCATTTTTCTTGAGACATGCC-3¢; reverse, 5¢-CTGGGATCCGTCCGAATCAGGTTCCTTC-3¢ (purchased from Sigma), and the pKK plasmid as a template [32] The resulting fragment was cloned into NcoI and BamHI sites of the ... Suv3(D1-159) and WNV NTPase/helicases The NTPase/helicase domain of HCV NS3 was expressed in E coli and purified as described previously [30], with certain modi...

Ngày tải lên: 08/03/2014, 02:20

9 666 0
Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

Báo cáo hóa học: " Non coding extremities of the seven influenza virus type C vRNA segments: effect on transcription and replication by the type C and type A polymerase complexes" ppt

... AGCAGGAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGUAGCAAGGGGUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUU AACUUUGGAAUAACAACUUAAAACAAUUA AGCAGGAGCAAGGGGAUUUUUUAACUUUGGAAUAACAACUUAAAACAAUUA ... AGCAGUAGCAAGAGGAUUUUUUCAUUUAAUGGAAUAACAAAAAUAUGUGCAAGUAGGAGGAAAGGGUUUAACAG CCCCUCC(UCA) AGCAGUAGCAAGGGGAUUUUUUCUUAUAAUGA(UCA) AGCAGUAGCAAGGGGAUUUUUGUUUUUUAUAAAACUGUACAAAAUAUUGACCAACACAU...

Ngày tải lên: 20/06/2014, 01:20

11 429 0
Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

Báo cáo y học: "Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report" pptx

... life-threatening complication of PEG-IFNa 2a treatment Abbreviations AA: aplastic anemia; AIHA: autoimmune hemolytic anemia; EBV: Epstein-Barr virus; HAA: hepatitis -associated aplastic anemia; Hb: ... Aplastic anemia associated with interferon alpha 2a in a patient with chronic hepatitis C virus infection: a case report Journal of Medical Case R...

Ngày tải lên: 11/08/2014, 03:21

5 354 0
Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

Hepatitis and Liver Cancer: A National Strategy for Prevention and Control of Hepatitis B and C pdf

... hepatitis < /b> B and < /b> hepatitis < /b> C are important public health problems and < /b> that there are several barriers to prevention < /b> and < /b> control < /b> efforts, such as a < /b> lack of < /b> knowledge and < /b> awareness about chronic ... chronic hepatitis < /b> B and < /b> hepatitis < /b> C, and < /b> conduct targeted active surveillance to monitor incid...

Ngày tải lên: 22/03/2014, 17:20

4 407 1
Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

Báo cáo sinh học: " The simultaneous presence and expression of human hepatitis C virus (HCV), human herpesvirus-6 (HHV-6), and human immunodeficiency virus-1 (HIV-1) in a single human T-cell" docx

... Con-1f1 Con-1r1 Con-1r2 U16-17F U16-17R gac act cca cca tag atc act c cat gat gca cgc tct acg aga c ctg tga gga act act gtc ttc acg cag cac tcg caa cca ccc tat cag cca gcn cac aaa ggn ata gga gg acb ... acb acy gcn cct tch cct ttc ccc aat ccc ccc ttt tct tta aaa tt cgt aga aca gaa gac cgg c aga act gca aat cgt tcc g [5] [5] [5] [5] [33] [33] [33] [34] [34] Page of (page number not for...

Ngày tải lên: 18/06/2014, 18:20

8 414 0
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc

Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc

... Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein A: ... ends, and a large open reading frame (ORF) encoding a 3010–3030 amino acid polyprotein that is co- and posttranslationally cleaved by cellular and viral proteases to...

Ngày tải lên: 19/06/2014, 08:20

19 375 0
Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

Báo cáo hóa học: " Complete genome of a European hepatitis C virus subtype 1g isolate: phylogenetic and genetic analyses" pptx

... Bracho MA, Carrillo-Cruz FY, Ortega E, Moya A, González-Candelas F: A new subtype of hepatitis C virus genotype 1: complete genome and phylogenetic relationships of an Equatorial Guinea isolate ... and participated in proofreading of the manuscript; FG -C coordinated the study, interpreted data, co-performed phylogenetic and genetic analyses and participate...

Ngày tải lên: 20/06/2014, 01:20

7 435 0
Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

Báo cáo hóa học: " Separation of Hepatitis C genotype 4a into IgG-depleted and IgG-enriched fractions reveals a unique quasispecies profile" docx

... to data analysis and preparation of manuscript HO'S performed all the experiments and contributed to data analysis and preparation of manuscript CM contributed to the experiments and data analysis ... outer forward, OF (I), ATGGCATGGGATATGAT; outer reverse, OR (I), AAGGCCGTCCTGTTGA; inner forward, IF (I), GCATGGGATATGATGATGAA; inner reverse, IR (I), GTCCTGTTGATGTGCCA The PCR rea...

Ngày tải lên: 20/06/2014, 01:20

9 289 0
Từ khóa:
w