A Convivial Approach for Description and Manipulation of Deductive and Stratified Databases

Báo cáo y học: " A computational approach for genome-wide mapping of splicing factor binding site" pdf

Báo cáo y học: " A computational approach for genome-wide mapping of splicing factor binding site" pdf

... Berstein and Yonina Eldar for advice on statistical analysis and mathematical formulations This work was supported by the Mallat Family Fund granted to YMG HDE was supported by the Israeli Science ... in Additional data file 1) The optimal set of parameters was: cutoffsig at a P-value of < 0.01, cutoffsub at a P-value of < 0.025, w = 50, and a = Although these were found as opti...

Ngày tải lên: 14/08/2014, 21:20

14 324 0
A semantic approach for scalable and self organized context aware systems

A semantic approach for scalable and self organized context aware systems

... A SEMANTIC APPROACH FOR SCALABLE AND SELF- ORGANIZED CONTEXT- AWARE SYSTEMS GU TAO NATIONAL UNIVERSITY OF SINGAPORE 2005 A SEMANTIC APPROACH FOR SCALABLE AND SELF- ORGANIZED CONTEXT- AWARE SYSTEMS ... characteristics of context information such as uncertainty, and provide a common platform for sharing and processing context information acros...

Ngày tải lên: 12/09/2015, 21:26

217 224 0
A unified approach for the performance analysis of unitary spare time block codes

A unified approach for the performance analysis of unitary spare time block codes

... estimation error with both spatial and temporal correlation, as well as with different modulation schemes CHAPTER IV A Unified Approach for the Performance Analysis of Unitary Space -Time Block Codes ... longer applicable and other approaches are needed Such an approach is presented in the next chapter, which presents a unified approach to evaluating the performa...

Ngày tải lên: 26/09/2015, 10:51

59 242 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...

Ngày tải lên: 18/06/2014, 15:20

9 778 0
Báo cáo hóa học: "Research Article A Rules-Based Approach for Configuring Chains of Classifiers in Real-Time Stream Mining Systems Brian Foo and Mihaela van der Schaar" pot

Báo cáo hóa học: "Research Article A Rules-Based Approach for Configuring Chains of Classifiers in Real-Time Stream Mining Systems Brian Foo and Mihaela van der Schaar" pot

... proposed a rules-based framework for reconfiguring distributed classifiers for a delay-sensitive stream mining application with dynamic stream characteristics By gathering information locally at each ... binary classifier partitions input data objects into two classes, a “yes” class H and a “no” class H A binary classifier chain is a special case of a binary classi...

Ngày tải lên: 21/06/2014, 19:20

17 419 0
Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx

Báo cáo hóa học: "An Artificial Intelligence Approach for Modeling and Prediction of Water Diffusion Inside a Carbon Nanotube'''' potx

... transformed data sets achieve better performance and faster convergence in general There are many transformation procedures that can be applied to a data set [22] In this study, the all data sets (i.e., ... Jang in 1991 [13, 14] More information regarding the architecture and the performance of ANFIS can be found in the literature [12] In what follows, first, performance of an MD sim...

Ngày tải lên: 21/06/2014, 20:20

5 426 0
Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

Báo cáo hóa học: " Research Article A Practical Approach for Simultaneous Estimation of Light Source Position, Scene Structure, and Blind Restoration Using Photometric Observations" pot

... Experimental results on depth estimation and blind restoration of images In order to obtain the depth map and blind restoration of images, we need to estimate the surface gradients and the blur parameter ... labels for estimating the same was chosen as 10 Figures 7 (a) and S Sharma and ManjunathV Joshi (a) (b) (c) Figure 8: Depth map for vase (a) ground truth and...

Ngày tải lên: 21/06/2014, 22:20

12 380 0
Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

Báo cáo khoa học: "Preoperative Y-90 microsphere selective internal radiation treatment for tumor downsizing and future liver remnant recruitment: a novel approach to improving the safety of major hepatic resections" docx

... Azekura K, Ueno M, Ohta K, Yamaguchi T, Matsubara T, Takahashi T, Nakajima T, Muto T, Ikari T, Yanagisawa A, Kato Y: Proliferative activity of intrahepatic colorectal metastases after preoperative ... 21:434-439 Makuuchi M, Thai BL, Takayasu K, Takayama T, Kosuge T, Gunvén P, Yamazaki S, Hasegawa H, Ozaki H: Preoperative portal embolization to increase safety of major hepatectomy...

Ngày tải lên: 09/08/2014, 04:21

7 384 0
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

... as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA Theoretical ... of the initial concept for comparative analysis between the DHD and CHD and and drafted the initial version of the manuscript GA dra...

Ngày tải lên: 13/08/2014, 16:20

29 430 0
optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

optimization of protein and rna detection methodologies and a new approach for manipulating protein activity in living cells

... 5’PHOS-GAACCGGAGCCGCAGCACCCGGGGCAGCAAGGCATT 27 GGGAAGCTTGCCACCATGGGTGACTGGAGTGCCTTGGGGAAATTACTGG ACAAGG 28 AAAAGGTACCGACCGGTTGAACCGCAATCTCCAGGTCATCAG 29 ACCATGGCCGGATCCGCTCGGTGGTGCTGCCC 30 GGGCAGCACCACCGAGCGGATCCGGCCATGGT ... TTTTAAGCTTGCCACCATGGCCGGATCCTAAGCGGCCGCAGCAAGGGCGAGGAG CTG 10 CCCCATCGATCTCGAGTTACTTGTACAGCTCGTCCAT 11 ACCTACAGGTGGGGTCTTTCATTCCC 12 AGCTCGTTTAGTGAACCGTCAGATC 13 GACAAGC...

Ngày tải lên: 13/11/2014, 10:46

144 311 0
A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

A new approach to semantic and syntactic functions of English adjectives – A contrastive analysis with their Vietnamese equivalents

... adjectives with the definitions of adjectives and their semantic and syntactic functions of English adjectives Chapter III is a study to a new approach to semantic and syntactic functions of English adjectives ... Graduation paper Declaration Title: A new approach to semantic and syntactic functions of English adjectives...

Ngày tải lên: 10/04/2013, 14:46

44 1,8K 9
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter The PCR products ... functions and intracellular signaling Thus, our system provides an accessible method to examine the endothelial cell biology of the mouse, and will accelerat...

Ngày tải lên: 18/02/2014, 17:20

11 875 0
w