Green chemistry and its role for sustainability

Tài liệu Báo cáo " English - A global language and its implications for students " ppt

Tài liệu Báo cáo " English - A global language and its implications for students " ppt

... language and two ways to make a language global , they are official status and education priority I also have given examples and cite ideas of [1] explanation to the way a language achieve the status ... cannot make a language global , many languages are easy to study in terms of grammar and vocabulary but they are not global Here, I agree with Crystal in respect of his p...

Ngày tải lên: 12/02/2014, 20:20

7 778 5
Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

Tài liệu Báo cáo khoa học: Interaction between very-KIND Ras guanine exchange factor and microtubule-associated protein 2, and its role in dendrite growth – structure and function of the second kinase noncatalytic C-lobe domain docx

... PDZ -domain- containing (FRMPD2) [8] and Ras guanine exchange factor (RasGEF) veryKIND (v-KIND, or kinase noncatalytic C-lobe domain containing 1) [9] The KIND domain in these proteins is localized to the ... determined the structural and functional properties of the protein protein interaction between v-KIND and MAP2 We defined the binding core regi...

Ngày tải lên: 14/02/2014, 19:20

11 659 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... occludin variant deleted in exon (OccDE9) On the basis of a comparative analysis of the involvement of wild-type occludin (OccWT) and variant occludin in apoptosis and invasion, as determined by assay, ... 5¢-CAGCAATTGTCACACATCAAGAA-3¢ (sense) and 5¢-T-ACATGTAGGTATGAAGACATCGTC T-3¢ (antisense) for exon 9; 5¢-TCCCTGCTTCCTCTGGC GGA-3¢ (sense) and 5¢-AGCCA...

Ngày tải lên: 18/02/2014, 18:20

12 619 0
Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

Tài liệu Báo cáo khoa học: High affinity copper binding by stefin B (cystatin B) and its role in the inhibition of amyloid fibrillation docx

... interface formed in the tetramer would disrupt copper < /b> binding < /b> Inhibition of amyloid fibril formation by < /b> stefin < /b> B in presence of copper < /b> The mechanism of amyloid fibril formation of cystatins is being studied ... histidine residues are central to copper < /b> binding < /b> in many proteins they probably form part of the copper < /...

Ngày tải lên: 19/02/2014, 06:20

14 587 0
Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

Tài liệu Báo cáo khoa học: Biochemical characterization of human 3-methylglutaconyl-CoA hydratase and its role in leucine metabolism docx

... Mack et al Human 3-methylglutaconyl-CoA hydratase Fig The metabolic pathway of (S) -leucine (L -leucine) and isovalerate Enzymes involved are as follows: 1, EC 2.6.1.42, branched chain amino transferase ... 3-MG-CoA hydratase reaction of leucine catabolism at the protein and DNA levels and developed a novel assay for enzyme analysis in a diagnostic setting The human A...

Ngày tải lên: 19/02/2014, 07:20

11 625 0
Tài liệu EXPLORING OPPORTUNITIES IN GREEN CHEMISTRY AND ENGINEERING EDUCATION ppt

Tài liệu EXPLORING OPPORTUNITIES IN GREEN CHEMISTRY AND ENGINEERING EDUCATION ppt

... accommodate green chemistry and engineering, such as: Offering green chemistry and engineering electives; and Having laboratory managers incorporate green chemistry and engineering concepts into laboratory ... into green chemistry and engineering by teaching it and speaking about it Green Chemistry and Green Engineering in Future Curriculum The p...

Ngày tải lên: 19/02/2014, 09:20

56 413 0
Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

Tài liệu Báo cáo khoa học: Inorganic pyrophosphatase in the roundworm Ascaris and its role in the development and molting process of the larval stage parasites doc

... that the hypodermis of the body wall, which synthesizes components of the cuticle, may offer a useful target for studies into the mechanism of the development and molting process in the roundworms ... presence of increasing concentrations of inhibitors for 10 days, and the number of molting larvae was determined Molting was manifested by shedding of...

Ngày tải lên: 20/02/2014, 11:20

13 699 0
Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

Báo cáo " A brief comparison of Vietnamese intonation and English intonation and its implications for teaching English intonation to Vietnamese EFL learners " pptx

... which are different in English and Vietnamese are addressed, and implications for teaching English intonation to Vietnamese learners are made Vietnamese words are primarily monosyllabic In the Vietnamese ... aspects of intonation can be easily compared in this study Implications for teaching English intonation to Vietnamese EFL learners The pr...

Ngày tải lên: 05/03/2014, 12:20

10 2K 17
An Equilibrium Model of Rare-Event Premia and Its Implication for Option Smirks potx

An Equilibrium Model of Rare-Event Premia and Its Implication for Option Smirks potx

... include Gilboa and Schmeidler (1989), Epstein and Wang (1994), Anderson, Hansen, and Sargent (2000), Chen and Epstein (2002), Hansen and Sargent (2001), Epstein and Miao (2003), Routledge and Zin (2002), ... Liu and Pan (2003), Liu, Longstaff, and Pan (2003) and Das and Uppal (2001) Dufresne and Hugonnier (2001) study the impact of event risk on pricing and hedging...

Ngày tải lên: 07/03/2014, 10:20

34 503 0
Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

Báo cáo khoa học: Molecular and functional characterization of a novel splice variant of ANKHD1 that lacks the KH domain and its role in cell survival and apoptosis docx

... sequence VBARP-L 1.9 VBARP-S 1.3 AACAATGCTGACTGATAGCGGAGGA (Forward) TAAGCTACTACGTAAAGAATATATC (Reverse) GATAAGGTACCTGCACTGACACGGATGAAAGC (Forward) CATATATTCTTTACGTAGTAGCTTA (Reverse) FEBS Journal 272 ... identified and functionally characterized VBARP, a novel splice variant of ANKHD1 Human ANKHD1 gene is a large transcript containing multiple ankyrin repeat motif domains a...

Ngày tải lên: 07/03/2014, 21:20

12 563 0
Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx

Báo cáo khoa học: "Categorial Fluidity in Chinese and its Implications for Part-of-speech Tagging" pptx

... verbalisation in Chinese was observed in Tai (1997) In other words, verbs are more freely deverbalised than nouns denominalised This fluidity between verbal and nominal status of verbs can in theory ... nouns, and the implications this phenomenon might have for POS tagging References Chinese Knowledge Information Processing Group (CKIP) 1993 iirt,=,m,3 }K (EN) Technical...

Ngày tải lên: 08/03/2014, 21:20

4 403 0
Solar and Space Physics and Its Role in Space Exploration doc

Solar and Space Physics and Its Role in Space Exploration doc

... Printing Office, Washington, D.C., 2004 SOLAR AND SPACE PHYSICS AND ITS ROLE IN SPACE EXPLORATION the fundamental role of solar and space physics research both in scientific exploration and in ... Solar and Space Physics and Its Role in Space Exploration Committee on the Assessment of the Role of Solar and Space Physics in...

Ngày tải lên: 14/03/2014, 10:20

74 371 0
Tin Foil and Its Combinations for Filling Teeth docx

Tin Foil and Its Combinations for Filling Teeth docx

... Tin Foil and Its Combinations for Filling by Henry L Ambler Title: Tin Foil and Its Combinations for Filling Teeth Author: Henry L Ambler Release Date: ... ask for something better, for the quality depends largely upon the kind and condition of the tin used and on the method of manufacture For making tin foil for filling teeth, the purest Ban...

Ngày tải lên: 15/03/2014, 19:20

49 271 0
Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

Báo cáo khoa học: Structural flexibility of the methanogenic-type seryl-tRNA synthetase active site and its implication for specific substrate recognition pptx

... oxygen for nucleophilic attack of the a-phosphate of ATP Thus, according to the crystal structure, the specificity of serine recognition depends on: (a) the zinc ion, (b) the size of the active site ... the importance of these residues for the flexibility of the tRNA 3¢-end binding region The ability of the loop to change its conformation upon...

Ngày tải lên: 16/03/2014, 06:20

14 359 0
w