Characterization, activity and kinetics of a visible light driven photocatalyst

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx

... work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun ... the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited the manuscript All authors read and approved the fin...

Ngày tải lên: 19/06/2014, 08:20

10 501 0
Báo cáo y học: "Practising evidence-based medicine: the design and implementation of a multidisciplinary team-driven extubation protocol" pptx

Báo cáo y học: "Practising evidence-based medicine: the design and implementation of a multidisciplinary team-driven extubation protocol" pptx

... potentially accelerate decision-making with regard to extubation; and to assess the safety and feasibility of our approach Materials and method The intervention was carried out in a 14-bed medical/surgical ... evidence-based medicine into the setting of the ICU by promoting a multidisciplinary approach to extubation, and to design a protocol that was acceptab...

Ngày tải lên: 12/08/2014, 18:21

6 331 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calc...

Ngày tải lên: 19/02/2014, 05:20

17 533 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC ... TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGA...

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx

... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A...

Ngày tải lên: 23/03/2014, 09:21

14 347 0
Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

Báo cáo khoa học: Purification and cloning of a Delta class glutathione S-transferase displaying high peroxidase activity isolated from the German cockroach Blattella germanica pptx

... of at least six classes of cytosolic GSTs in insects [2] The majority of GSTs are in the Delta and Epsilon classes, and the remaining enzymes are in the Omega, Sigma, Theta and Zeta classes The ... cockroach, Blattella germanica (L.) Pestic Biochem Physiol 61, 53–62 Yu SJ & Huang SW (2000) Purification and characterization of glutathione S-transferases fro...

Ngày tải lên: 23/03/2014, 09:21

11 427 0
Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

Báo cáo khoa học: A peptide derived from cyclin-dependent kinase activator (p35) specifically inhibits Cdk5 activity and phosphorylation of tau protein in transfected cells pdf

... CIP are indicated by the labelled arrows (B) A combination of N-terminal and C-terminal truncations of p35 produces a nonactivating fragment (154–279, CIP) that inhibits Cdk5 activity and binds ... using anti-p35 (C-19) Left lane, cotransfected with Cdk5, p35 and tau; Right lane, cotransfected with Cdk5, p25 and tau (B) Total tau and phospho -tau were analyzed...

Ngày tải lên: 23/03/2014, 21:21

8 330 0
Báo cáo Y học: Thermodynamics and kinetics of the cleavage of DNA catalyzed by bleomycin A5 A microcalorimetric study pdf

Báo cáo Y học: Thermodynamics and kinetics of the cleavage of DNA catalyzed by bleomycin A5 A microcalorimetric study pdf

... absorbance for the reaction system after the cleavage Ó FEBS 2002 Thermokinetics of DNA cleavage catalyzed by BLM -A5 (Eur J Biochem 269) 2855 Table Thermodynamic and kinetic data of the cleavage ... cleavage of calf thymus DNA induced by BLM -A5 and those for the scission of calf thymus DNA mediated by two DNA- damaging agents, ADM and (1,10-...

Ngày tải lên: 24/03/2014, 04:21

9 468 0
Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

Báo cáo hóa học: " Development and application of a biomarker assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood" pptx

... biomarkers, and they participated in the data analyses AAH developed the customized Spotfire tool used for data analyses and reviewed statistical analyses YG participated in the assessment and ... assay for determining the pharmacodynamic activity of an antagonist candidate biotherapeutic antibody to IL21R in whole blood Journal of Translati...

Ngày tải lên: 18/06/2014, 16:20

13 530 0
báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

báo cáo hóa học: "Ambulatory measurement of knee motion and physical activity: preliminary evaluation of a smart activity monitor" pdf

... property Data Analysis Data were processed and analyzed after testing each subject The same time interval of BML and IDEEA data was analyzed for the three specific physical activities (gait, stepping, ... measure knee flexion angles and were calibrated by MiniSun, LLC One electrogoniometer was placed on the lateral surface of each knee, in line with the anatomic axes of the f...

Ngày tải lên: 19/06/2014, 10:20

10 378 0
báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

báo cáo hóa học:" Characterization of the tumor marker muc16 (ca125) expressed by murine ovarian tumor cell lines and identification of a panel of cross-reactive monoclonal antibodies" docx

... MOVCAR-9 MOVCAR-10 MOVCAR-1 MOVCAR-2 MOVCAR-9 MOVCAR-10 Figure Extra -and intracellular Muc16 expression by MOVCAR cells Extra -and intracellular Muc16 expression by MOVCAR cells (A) MOVCAR-10 cells ... cDNA was prepared cDNA was amplified with the following primer pairs from Integrated DNA Technologies: Muc16 5'-TGCCACCTACCAGTTGAAAG-3' and 5'-GTACCGCCAAGCAGATGAG-3'; GAPDH 5'-...

Ngày tải lên: 20/06/2014, 07:20

7 431 0
Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

Báo cáo y học: "Analysis of immunoglobulin light chain rearrangements in the salivary gland and blood of a patient with Sjögren’s syndrome" pptx

... daily at the time of analysis After developing parotid gland enlargement, lymphoma of the parotid gland was excluded by partial parotidectomy and histological examination After approval by the ... typically present in sera of patients with SS [18] and was also detected in the saliva or in salivary gland biopsies [19] of these patients In this regard, Mart...

Ngày tải lên: 09/08/2014, 03:24

12 441 0
Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx

Báo cáo y học: "Biologic activity and safety of belimumab, a neutralizing anti-B-lymphocyte stimulator (BLyS) monoclonal antibody: a phase I trial in patients with systemic lupus erythematosus" potx

... and was safely administered to patients with SLE These findings supported the initiation of phase II studies investigating the safety and clinical activity of belimumab in patients with SLE and ... enrolled in the trial Eligible patients had stable SLE disease activity, as clinically judged by the principal investigator, for at least months before screening a...

Ngày tải lên: 09/08/2014, 13:21

15 479 0
báo cáo khoa học: " Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)" pptx

báo cáo khoa học: " Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.)" pptx

... doi:10.1186/1471-2229-11-43 Cite this article as: Keeling et al.: Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.) BMC Plant Biology 2011 ... feeding and some distance away [29] Functional characterization of monoterpene synthases: (-)-Linalool synthases We characterized two...

Ngày tải lên: 11/08/2014, 11:21

14 360 0
báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

báo cáo khoa học: " Characterization and isolation of a T-DNA tagged banana promoter active during in vitro culture and low temperature stress" ppt

... 20 Isolation and characterization of T-DNA flanking sequences Isolation of T-DNA flanks was accomplished with Thermal Asymmetric Interlaced-PCR (TAIL-PCR) and Inverse PCR (I-PCR) TAIL-PCR was ... Sequences were analyzed with BLASTn and BLASTx http://www.ncbi.nlm.nih.gov/BLAST/ programs against the GenBank database, and against a banana EST database donated by Syngent...

Ngày tải lên: 12/08/2014, 03:20

15 284 0
w