8964 rihanna an rn b star from the carribean

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

Báo cáo khoa học: Increased susceptibility of b-glucosidase from the hyperthermophile Pyrococcus furiosus to thermal inactivation at higher pressures pptx

... 10 of the experiment This inactivation was not due to a temperature rise during pressurization The b-glucosidase from P furiosus does not become inactivated after weeks of storage at temperatures ... compared to that of unpressurized samples The influence of pressure treatment on enzyme inactivation The inactivation of b-glucosidase was measured after pres...

Ngày tải lên: 07/03/2014, 03:20

9 344 0
Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx

Báo cáo khoa học: Shewasin A, an active pepsin homolog from the bacterium Shewanella amazonensis pptx

... Purification and analysis of recombinant shewasin A active site mutant The active site mutant shewasin A_(D37A) was expressed in E coli, purified according to the protocol optimized for shewasin A ... positive mutant clones were confirmed by DNA sequencing Expression and purification of recombinant shewasin A and the active site mutant in E coli Wild-type shewasin A and she...

Ngày tải lên: 14/03/2014, 22:20

10 568 1
Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

Báo cáo khoa học: NMR studies on the interaction of sugars with the C-terminal domain of an R-type lectin from the earthworm Lumbricus terrestris pot

... compilation ª 2009 FEBS 2101 Interaction of EW29Ch with sugars H Hemmi et al constants by NMR to analyze the interaction between the protein and lactose in a solution state As mentioned above, one of ... affect the dissociation constants By contrast, because chemical-shift changes upon the addition of sugars at subdomain c were in the fast exchange regime, Kd value...

Ngày tải lên: 23/03/2014, 04:21

11 459 0
Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

Báo cáo khoa học: Molecular cloning and functional expression of a gene encoding an antiarrhythmia peptide derived from the scorpion toxin pptx

... E.P., Martin-Eauclaire, M.F., Mansuelle, P & Sampieri, F (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the alpha- and beta-sites of the mammalian ... Sampieri, F & Granier, C (1991) An anti-insect toxin purified from the scorpion Androctonus australis Hector also acts on the a- and b-sites of the mammalian s...

Ngày tải lên: 31/03/2014, 09:20

8 474 0
Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

Tài liệu Báo cáo khoa học: Functional characterization of an orphan cupin protein from Burkholderia xenovorans reveals a mononuclear nonheme Fe2+-dependent oxygenase that cleaves b-diketones ppt

... metal–ligand distances (Table 2) compare very favorably with data in the protein database, from ˚ which an average distance of 2.03 A for Fe–N(His) was inferred [38], and a target distance of ... from genomic DNA of B xenovorans LB400 through a PCR with GAGCGGCATATGGA AATCAAACCGAAGGTTCGCGA and GAGCGGCATA TGGAAATCAAACCGAAGGTTCGCGA as the forward and reverse oligonucleotid...

Ngày tải lên: 18/02/2014, 06:20

15 625 0
Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

Tài liệu Báo cáo khoa học: An alternative transcript from the death-associated protein kinase 1 locus encoding a small protein selectively mediates membrane blebbing pdf

... plays an important role in the membrane- blebbing process [19 ], DAPK -1 and s-DAPK -1 may be able to interact with ankyrin B via their ankyrin repeats and thus promote membrane blebbing Although these ... membrane- blebbing assay, we evaluated the activity of the mutant with the tail deletion (Flag-TD; s-DAPK1Dtail) and the protease-resistant substitution (FlagTM1; s-...

Ngày tải lên: 18/02/2014, 17:20

11 660 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... Molecular and biochemical characterisation of the thermo-active family pectate lyase from the hyperthermophilic bacterium Thermotoga maritima Biochem J 370, 651659 21 Kozianowski G, Canganella F, ... as the rst and only product on PGA and oligoGalpA On the basis of its mode of action, PelB should be classied as an exopolygalacturonase (EC 3.2.1.67) To date...

Ngày tải lên: 20/02/2014, 03:20

10 594 0
Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

Tài liệu Báo cáo Y học: Purification, characterization, immunolocalization and structural analysis of the abundant cytoplasmic b-amylase from Calystegia sepium (hedge bindweed) rhizomes ppt

... b-amylase (Cys83, Cys96, Cys209 and Cys344) are homologous to those found in soybean b-amylase (Cys82, Cys97, Cys208 and Cys343) On the analogy of the soybean b-amylase, the active site of the ... for the b-amylase from C sepium using the X-ray coordinates of the soybean b-amylase (Fig 4) According to the Ramachandran plot of this model the f and c...

Ngày tải lên: 22/02/2014, 07:20

11 613 0
Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot

Báo cáo khoa học: Crystal structures of the apo form of b-fructofuranosidase from Bifidobacterium longum and its complex with fructose pot

... native enzyme and its complex with the product of hydrolysis – fructose The crystals of raffinose ($ 0.1 mg) were added to the crystallization drop with the apo crystals of b-fructofuranosidase ... of fructose The leaving group is carboxylate of Asp54 Dimerization The asymmetric units of the crystals of both the apo and complexed form of...

Ngày tải lên: 06/03/2014, 00:21

17 522 0
Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

... [29], and in fact have a small number of predators The pH stability of ovorubin is within the pH range of vertebrate digestive tract fluids [30,31], and the present results indicate that the protein ... different pH values Solid line: pH 6.0 Dotted line: pH 4.5 Dashed line: pH 2.0 On the basis of the above results, the CD spectra in the near-UV and...

Ngày tải lên: 07/03/2014, 06:20

9 431 0
Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

Báo cáo khóa học: A new UV-B absorbing mycosporine with photo protective activity from the lichenized ascomycete Collema cristatum docx

... having a great potential to protect from UV-B radiation Collemin A is a new mycosporine, which Fig Comparative UV spectra of the fungus (mycobiont) and lichen Collema cristatum The mycobiont has a ... mammals because photosynthetic organisms depend on solar irradiation as their primary source of energy, and at the same time must provide a mechanism that can countera...

Ngày tải lên: 07/03/2014, 15:20

5 451 0
Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

Báo cáo Y học: Structural and biochemical characterization of calhepatin, an S100-like calcium-binding protein from the liver of lungfish (Lepidosiren paradoxa) docx

... analysis The 105 000 g supernatant of lungfish liver (lane 1), skeletal muscle (lane 2), intestine (lane 3), lung (lane 4), brain (lane 5), adipose tissue (lane 6), heart (lane 7) and skin (lane ... showed that the protein is in a monomer–dimer equilibrium and that the dissociation constant is in the micromolar range for the apoprotein and in the submicromolar range f...

Ngày tải lên: 08/03/2014, 22:20

9 446 0
Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

Báo cáo Y học: Ferritin from the spleen of the Antarctic teleost Trematomus bernacchii is an M-type homopolymer doc

... Ferritin from the spleen of another Antarctic teleost, G acuticeps, likewise is a homopolymer that is rich in iron [12] It appears therefore that Antarctic fish ferritins not require heteropolymeric ... compare the stability of T bernacchii ferritin with that of L-type and H-type mammalian ferritins, which are known to dissociate at pH 2.5 and 2.8–3.0, respective...

Ngày tải lên: 08/03/2014, 23:20

7 609 0
Từ khóa:
w