Cardiac muscle tissue
MÔ CƠ (Muscle Tissue)
... bào 2 CƠ VÂN / THỊT (Skeletal tissue) Cơ vân loại bắp tay, bắp chân, đùi, mông, v.v… Mỗi bắp gồm nhiều sợi hợp thành Mỗi sợi thể hợp bào, có chiều dài từ - 45 cm, đường kính 100 micron CƠ VÂN ... ngang đĩa A - Sơi actin - Sơ myozin 3 CƠ TIM (cardiac tissue) Cơ tim tổ chức đặc biệt, mang đặc tính vân trơn Cơ tim thành phần tạo nên thành tim động vật Cơ tim giống vân chổ bao gồm...
Ngày tải lên: 23/10/2013, 17:20
báo cáo hóa học: " A swimming robot actuated by living muscle tissue" docx
... muscle installation into the robotic swimmer was approximately hour Table I: Muscle actuator parameters and swimming robot performance parameters (mean values, N = 4) at the maximum forward swimming ... of muscle actuator performance, swimming efficiency and locomotory maneuverability Each robotic platform was designated "B1x", where "x" indicated the build-up, serialized as "a,...
Ngày tải lên: 19/06/2014, 10:20
Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 2 potx
... 3 CƠ TIM (cardiac tissue) Cơ tim tổ chức đặc biệt, mang đặc tính vân trơn Cơ tim thành phần tạo nên thành tim động vật Cơ tim giống vân chổ bao gồm nhiều nhân giống trơn chổ nhân nằm tế bào Về ... CẤU TẠO SIÊU VI SỢI CƠ VÂN - Túi tận cùng; - Túi H; - Ống nội; - Ty thể; - T vi quản T ống ngang; - Màng sợi cơ; - Màng đáy; - Sợi võng; - Tơ TƠ CƠ VÂN a - Cấu tạo vi thể tơ vân; ... bà...
Ngày tải lên: 25/07/2014, 10:22
Đại cương về Mô và Phôi : MÔ CƠ (Muscle Tissue) part 1 pps
... tạo sợi vân: Màng c : Màng mỏng, gồm hai lớp: lớp nằm phỉa tương đương với màng tế bào, lớp màng liên kết gồm sợi sinh keo xếp thành dây Hai màng cách khoảng từ 14 0 - 240 A0 Cơ tương: Cũng giống ... bào 2 CƠ VÂN / THỊT (Skeletal tissue) Cơ vân loại bắp tay, bắp chân, đùi, mông, v.v… Mỗi bắp gồm nhiều sợi hợp thành Mỗi sợi thể hợp bào, có chiều dài từ - 45 cm, đường kính 10 0 micr...
Ngày tải lên: 25/07/2014, 10:22
Báo cáo y học: " Propagated repolarization of simulated action potentials in cardiac muscle and smooth muscle" pptx
... resting potential (RP) and predominate during the rising phase and plateau phase of the AP The myocardial cell was assumed to be a cylinder 150 µm long and 16 µm in diameter, and the smooth muscle ... resistance of K+ compared to Na+ (cardiac muscle) or Ca++ (smooth muscle) were set to give resting potentials (RPs) of -80 mV for cardiac muscle and -55 mV for s...
Ngày tải lên: 13/08/2014, 22:22
Báo cáo y học: "Repolarization of the action potential enabled by Na+ channel deactivation in PSpice simulation of cardiac muscle propagation" ppt
... because of instability in the PSpice pro- gram, the problem was solved by inserting the BB-2 into the Na+ leg to produce deactivation of the Na+ conductance turned on by the first BB (BB-1) BB-2 ... are in the same leg of the Hodgkin-Huxley circuit, namely the Na+ conductance leg The first BB produced activation of the Na+ conductance, and th...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: " Effect of transverse gap-junction channels on transverse propagation in an enlarged PSpice model of cardiac muscle" pps
... plots in panel A show that when there were no or few (0 or 10) longitudinal gj -channels, adding many transverse gj -channels had no effect on TPT In contrast, when there were many longitudinal channels ... 2: Summary of Total Propagation Time (TPT) and Velocity (θ) for Various combinations of longitudinal and transverse gapjunction channels in the 10 × 10 model for...
Ngày tải lên: 13/08/2014, 23:20
Báo cáo y học: "Propagation velocity profile in a cross-section of a cardiac muscle bundle from PSpice simulation" pdf
... cross-sectional profile of longitudinal propagation velocities of simulated APs through a small-diameter bundle of cardiac muscle fibers indicates that velocity is lower in the depths of the bundle than at ... chains of the cardiac bundle Figure Action potential (AP) traces recorded intracellularly in cells 1, 5, and 10 of each of the 20 parallel chains of...
Ngày tải lên: 13/08/2014, 23:20
Tài liệu Báo cáo khoa học: Regulation of connective tissue growth factor (CTGF/CCN2) gene transcription and mRNA stability in smooth muscle cells Involvement of RhoA GTPase and p38 MAP kinase and sensitivity to actin dynamics docx
... preponderant role of p38 in the regulation of gene expression at the level of mRNA stability The p38 MAP kinase is now known to stabilize a wide range of mRNAs including those encoding TNF-a, interferon ... organization of the actin cytoskeleton and the superinduction of the CTGF/ CCN2 gene Rho-like GTPases play a pivotal role in orchestrating changes...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Cardiac ankyrin repeat protein is a marker of skeletal muscle pathological remodelling pot
... TCAGAGTTCCCTACCGAAGCAG MH181PO.F: CTCCAAGCAGATGCAGCAGA M225PO.P: CCGTGGTGCTGATGGGCAAGAA M267PO.R: ACCATGATGCGCAAGGCCAT 1584p21.F: GTACAAGGAGCCAGGCCAAG 1629p21.P: TCACAGGACACTGAGCAATGGCTGATC 1691p21.R: ... CGCACTGTAAGACCCCAACA 6mC9.F: TCTGCACCCTCACCGTCTTC 58mC9.P: TCTCGAAGATATGACTCCAGGACCACAATATTTTCT 135mC9.R: GGCTTCCATGGCATACTCCA 616mCARP.F: CTTGAATCCACAGCCATCCA 641mCARP.P: CATGTCGTGGAGGAAACG...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: A new pathway encompassing calpain 3 and its newly identified substrate cardiac ankyrin repeat protein is involved in the regulation of the nuclear factor-jB pathway in skeletal muscle pdf
... CGGCCCGGGAACTGATTAAGAGTCTGTCG GAGCCATGGAACAACGGAAAAGCGAGAAAC CGGCCCGGGAACTGATTAAGAGTCTGTCG CACCATGATGGTACTGAGAG GAATGTAGCTATGCGAGAGTTC CACCATGGCCGAGTTCAGAAATGGAGAAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAGACACTTCCGGCCAACAG ... CACCATGCTGAAGACACTTCCGGCCAACAG GAATGTAGCTATGCGAGAGTTC CACCATGCTGAAAGCTGCGCTGGAGAAC GAATGTAGCTATGCGAGAGTTC CACCATGACCAAAGTTCCAGTTGTGAAGG GAATGTAGCTATGCGAGAGTTC CACCATGATGGTA...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo y học: "Human cardiac tissue in a microperfusion chamber simulating extracorporeal circulation ischemia and apoptosis studies" docx
... impact on the calcium homoeostasis in the cardiomyocytes the initial and final calcium ratio values had to be analyzed This was defined as Δ-ratio; Δ-ratio = ratiofinal-ratioinitial Significant ... routine preoperative examinations, patient evaluation and participated in the study design and coordination EU performed the statistical analysis MR and MM participated in the experim...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo khoa học: "Erythropoietin improves skeletal muscle microcirculation and tissue bioenergetics in a mouse sepsis model" ppsx
... received general anaesthesia with ketamine/xylazine 80:10 mg/kg via intraperitoneal injection Sepsis was induced by cecal ligation and perforation (CLP) An incision was made along the linea alba The ... tissues in the cardiovascular system, including cardiomyocytes, vascular smooth muscle, and endothelial cells, and has been shown to mediate anti-apoptotic, anti-inflammatory, and...
Ngày tải lên: 13/08/2014, 03:21
Báo cáo y học: "Prediction of hospital outcome in septic shock: a prospective comparison of tissue Doppler and cardiac biomarkers" pdf
... (angina or myocardial infarction) or cardiac surgery Echocardiography Materials and methods This prospective observational study was approved by the Princess Alexandra Hospital Human Research Ethics ... Department of Echocardiography, Princess Alexandra Hospital, Ipswich Road, Brisbane, 4102, Australia 4Department of Intensive Care, Princess Alexandra Hospital, Ipswich Road, Bri...
Ngày tải lên: 13/08/2014, 20:21
EFFECT OF CORONARY PERIVASCULAR ADIPOSE TISSUE ON VASCULAR SMOOTH MUSCLE FUNCTION IN METABOLIC SYNDROME
... Metabolic Syndrome and Coronary Artery Disease Coronary Microvascular Dysfunction in Metabolic Syndrome Coronary Macrovascular Dysfunction in Metabolic Syndrome Adipose Tissue, Distribution ... Owen EFFECT OF CORONARY PERIVASCULAR ADIPOSE TISSUE ON VASCULAR SMOOTH MUSCLE FUNCTION IN METABOLIC SYNDROME Obesity increases cardiovascular diseas...
Ngày tải lên: 24/08/2014, 12:30