Positive discipline in the inclusive , learning friendly classroom a guide for teachers teacher educators

Positive discipline in the inclusive , learning friendly classroom a guide for teachers  teacher educators

Positive discipline in the inclusive , learning friendly classroom a guide for teachers teacher educators

... pleading, bribing, yelling, commanding, name-calling, forced labour, and other even more humiliating actions  Positive Discipline in the Inclusive, Learning- Friendly Classroom What is an Inclusive, ... are maintaining social harmony and learning to use mental abilities to discipline the body, especially in terms Positive Discipline in the Inclusive, Learning...

Ngày tải lên: 25/08/2016, 12:43

119 431 0
the mobile frontier [electronic resource] a guide for designing mobile experiences

the mobile frontier [electronic resource] a guide for designing mobile experiences

... data and data patterns as if they were a biological form The dynamic and life-like qualities of data are celebrated Systems allow information to form and reform by connecting to other data, making ... novel Alice in Wonderland, is an alternate paradigm a world where playing cards are animated and animals can talk The Emergent Mobile NUI Paradigm 13 The concept of paradigms, and mor...

Ngày tải lên: 30/05/2014, 00:15

280 3,3K 0
Tài liệu Building Solutions in Microsoft® Exchange 2000 with the Web Storage System Classroom Setup Guide pptx

Tài liệu Building Solutions in Microsoft® Exchange 2000 with the Web Storage System Classroom Setup Guide pptx

... Microsoft Excel 2000 ! Microsoft FrontPage® 2000 ! Microsoft Outlook® 2000 ! Workflow Designer for Exchange 2000 ! Web Storage System Tools (Web Storage System Explorer) ! Web Storage System SDK ! ... click OK Classroom Setup Guide 13 ! Configure the non-MAPI folder in Exchange System Manager Click Start, point to Programs, point to Microsoft Exchange...

Ngày tải lên: 11/12/2013, 14:15

24 497 0
Báo cáo hóa học: " Research Article Multiple Positive Solutions in the Sense of Distributions of Singular BVPs on Time Scales and an Application to Emden-Fowler Equations" docx

Báo cáo hóa học: " Research Article Multiple Positive Solutions in the Sense of Distributions of Singular BVPs on Time Scales and an Application to Emden-Fowler Equations" docx

... existence of solutions in the sense of distributions to P Under certain hypotheses, we approximate solutions in the sense of distributions to problem P by a sequence of weak solutions to weak ... the first relation in 2.23 Therefore, v is a nontrivial function Results on the existence and uniqueness of solutions In this section, we will deriv...

Ngày tải lên: 22/06/2014, 11:20

13 374 0
Effect of Na2SO4 additive in positive electrodes on the performance of sealed lead-acid cells for electric scooter applications ppt

Effect of Na2SO4 additive in positive electrodes on the performance of sealed lead-acid cells for electric scooter applications ppt

... This study investigated the effects of Na SO4 additive in the positive electrode on the performance of VRLA cells Based on the results presented herein, we can conclude the following Ž1 The XRD ... composition is independent of the amount of Na SO4 additive in the positive electrodes Plate composition relies heavily on the cure temperature con...

Ngày tải lên: 05/07/2014, 21:20

10 526 0
how to get a higher ielts score by building a positive image in the examiner''''''''s mind

how to get a higher ielts score by building a positive image in the examiner''''''''s mind

... Training Writing Task Creating a good impression in your WRITING – GENERAL TRAINING Writing task easy you have more freedom to choose what to say than in the Academic Writing task Tips to Writing ... summarise To build a good impression in the assessor’s mind in the Speaking test Think about: To impress and connect with the assessor during the Speaking test:...

Ngày tải lên: 30/07/2014, 12:22

65 434 0
Using information technology in teaching and learning reading skill of english for biology for 2nd-year students

Using information technology in teaching and learning reading skill of english for biology for 2nd-year students

... mentioned and discussed: (1) model of teaching ESP reading with computers, (2) programmes used in reading ESP teaching and learning and (3) advantages of using computers in reading ESP teaching and learning ... computers for teaching and learning (in general) and teaching and learning FL (in particular) As far as this study is concerned, cer...

Ngày tải lên: 07/11/2012, 14:31

43 1,4K 8
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... TGGGGAGGACTTTTATGCTGT CTTTTGTGTAGGTGGGATTCG CTGAGGTTACAGACAACTGTTC CCTTTGACATCGCAAGTGGATCA TTGAGGTGACAGACAATTGCCT TCTTTGACTTCTCAAACTGATCG GCGGCCGCCACCATGCATCATCACCATCAC CATGTCAGCCGTTTTGAACAC GCGGCCGCCACCATGCATCATCACCATCAC ... RPE6 5a- His-Fwd NA TGCARRAAYATHTTYTCCAG AYRAAYTCRWRBCCYTTCCA GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC GATATCTTATGGTTTGTACATCCCATGGAAAG GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC AAGCTT...

Ngày tải lên: 14/02/2014, 14:20

14 755 0
Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

Tài liệu Báo cáo khoa học: Electrostatic role of aromatic ring stacking in the pH-sensitive modulation of a chymotrypsin-type serine protease, Achromobacter protease I pdf

... 2002 Aromatic stacking in API (Eur J Biochem 269) 4153 Fig Stick models of the reactive site in bovine trypsin and API The catalytic triad residues of trypsin and API are Ser195–His57– Asp102 and ... because several serine proteases not have an aspartate as the catalytic apparatus M NaCl However, for chymotrypsin-type serine proteases, the replacement of this aspar...

Ngày tải lên: 21/02/2014, 03:20

7 607 0
Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx

Tài liệu RESULTS BASED MANAGEMENT IN THE DEVELOPMENT CO-OPERATION AGENCIES: A REVIEW OF EXPERIENCE docx

... that it was a key feature in the reform efforts of all ten Performance management, also referred to as results based management, can be defined as a broad management strategy aimed at achieving ... Management, Operations Evaluation Department, World Bank, 1997 Results Based Management in Canadian International Development Agency, CIDA, January 1999 The basic pur...

Ngày tải lên: 21/02/2014, 11:20

158 575 0
Estrogen in the adult male reproductive tract: A review ppt

Estrogen in the adult male reproductive tract: A review ppt

... Although estrogen effects in the developing male are important, such studies have not actually proven that estrogen has a role in the adult male reproductive organs At best, it was thought that an estrogen ... sections and the ER21 antibody, which is made against a peptide containing the first 21 amino acids of the rat and human ERα (does not cross-react with E...

Ngày tải lên: 05/03/2014, 17:20

14 374 0
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt

... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing...

Ngày tải lên: 06/03/2014, 09:22

15 546 0
w