The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt

The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt

The Transformation of Escherichia coli with Deoxyribonucleic Acid isolated from Bacteriophage Adgt

... which are more thermolabile than is the DNA The characterization of the heat stability of the infectious activity of the > dg DNA preparation should therefore determine whether the DNA or some ... on the basis of the protein assay of Lowry et al (1951) and less than or equal to 0·001 on the basis of sulfur content Furthermore, from the equality of the act...

Ngày tải lên: 28/05/2016, 11:25

25 176 0
investigating the mechanism of escherichia coli min protein dynamics

investigating the mechanism of escherichia coli min protein dynamics

... presence of the MinE deletion mutants 144 Cellular location of Gfp-MinD in the presence of increasing levels of MinE-M and MinE1-33-M 145 Localization of MinE deletion mutants in the presence of MinD ... With the aim of gaining a better understanding of the roles ATP and MinE play in the reversible association of the Min proteins with the membrane, we explo...

Ngày tải lên: 13/11/2014, 10:02

238 104 0
Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

Báo cáo khoa học: Structural and functional consequences of single amino acid substitutions in the pyrimidine base binding pocket of Escherichia coli CMP kinase pdf

... with the amino group and the N3 atom of the cytosine (Fig 1) This study uses site-directed mutagenesis to further explore the contribution of these amino acids interacting with the pyrimidine ring ... consisting of three domains, the CORE, the LID and the NMPbind [1] A characteristic of bacterial CMP kinases is an extension of the NMPbind domain by 40...

Ngày tải lên: 16/03/2014, 10:20

11 445 0
Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the specificity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf

Tài liệu Báo cáo khoa học: Ionic strength and magnesium affect the specificity of Escherichia coli and human 8-oxoguanine-DNA glycosylases pdf

... evaluate the effects of ionic strength and Mg2+ on the activity and specificity of OGG1, we measured the apparent values of k2 and k3 under conditions of low salt (KPi only) and no Mg2+, low salt and ... Effects of ionic strength and divalent cations on the activity and specificity of Fpg and OGG1 The conditions inside a living cell differ from...

Ngày tải lên: 18/02/2014, 18:20

14 568 0
Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

Tài liệu Báo cáo khóa học: The C-terminal domain of Escherichia coli Hfq increases the stability of the hexamer ppt

... The role of the C-terminal domain on Hfq (Eur J Biochem 271) 1259 the model further confirmed by determination of the X-ray structure of Staphylococcus aureus and E coli Hfq proteins [19,20] Hfq ... binding of the polyadenylated rpsO RNA We have shown that the presence of the remainder of the acidic tail results in the thermodynamic stabilization of...

Ngày tải lên: 19/02/2014, 12:20

8 428 0
Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt

Tài liệu Báo cáo Y học: Insights into the reaction mechanism of Escherichia coli agmatinase by site-directed mutagenesis and molecular modelling ppt

... with the sequences of 1CEV and 1RLA and pasted into the structural alignment The alignment was then corrected by hand Since the sequences of the two arginases and agmatinase greately differ in the ... that the environment of tryptophan residues is essentially conserved in the mutant enzyme On the other hand, the absence of major differences in the CD...

Ngày tải lên: 21/02/2014, 01:21

5 475 0
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx

... ACACCCATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified TEHA3: ACACAGATCTCTGCAGTGAAATGAGCTGTTGACAATTA and TEHA4: ACACCCATGGTCTGTTTCCTGTG were used for trc amplification The exact nucleotide sequence of each promoter ... protein was obtained from the SDS ⁄ PAGE and western blotting analyses and compared with the data obtained when analyzing the same protein in vitro Because eGFP...

Ngày tải lên: 06/03/2014, 01:20

11 451 0
Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

Báo cáo khoa học: The role of evolutionarily conserved hydrophobic contacts in the quaternary structure stability of Escherichia coli serine hydroxymethyltransferase pptx

... helix of the third cluster of CHCs is part of the inter-domain segment and the other helix lines the boundary between the major domain and the N-terminus (Fig 1) Therefore, the formation of the ... rather than functional role Role of hydrophobic contacts in serine hydroxymethyltransferase In the present study, the importance of the third hydrop...

Ngày tải lên: 07/03/2014, 03:20

12 583 0
ANTIBIOTIC RESISTANCE OF ESCHERICHIA COLI ISOLATED FORM POULTRY WORKERS, PATIENTS AND CHICKEN IN THE EASTERN PROVINCE OF SAUDI ARABIA ppt

ANTIBIOTIC RESISTANCE OF ESCHERICHIA COLI ISOLATED FORM POULTRY WORKERS, PATIENTS AND CHICKEN IN THE EASTERN PROVINCE OF SAUDI ARABIA ppt

... 1996) In conclusion, our data demonstrate alarmingly high individual and multiple resistance to antibiotics in E coli, reflecting the misuse of these agents in the poultry industry Since chicken ... Clinical Laboratory Standards (NCCLS 1993) In addition, E coli organisms isolated from chicken and Table Comparison of pattern of resistance of E coli isola...

Ngày tải lên: 08/03/2014, 09:20

6 328 1
Báo cáo khoa học: Monomeric solution structure of the helicase-binding domain of Escherichia coli DnaG primase pdf

Báo cáo khoa học: Monomeric solution structure of the helicase-binding domain of Escherichia coli DnaG primase pdf

... half of them The present structure of monomeric E coli DnaG- C identifies the earlier crystal structure of the same protein as a domain- swapped dimer, in which helix of one monomer binds to the ... and of P16 (Fig 1) Helices 5002 Fig Stereo views of the solution and crystal structures of DnaG- C (A) Superposition of the backbone atoms of residues 447...

Ngày tải lên: 16/03/2014, 12:20

13 247 0
Báo cáo Y học: The phosphotransferase system of Streptomyces coelicolor IIACrr exhibits properties that resemble transport and inducer exclusion function of enzyme IIAGlucose of Escherichia coli pptx

Báo cáo Y học: The phosphotransferase system of Streptomyces coelicolor IIACrr exhibits properties that resemble transport and inducer exclusion function of enzyme IIAGlucose of Escherichia coli pptx

... hypothesis The demonstration of the IIACrr MalK interaction suggests that IIACrr may regulate the function of some of the > 140 MalK homologues found in the S coelicolor genome The one with the ... investigate is whether the mechanism of inducer exclusion is realized in S coelicolor Our observation that IIACrr could replace the inducer exclusion...

Ngày tải lên: 17/03/2014, 23:20

8 568 0
Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx

Báo cáo khoa học: The pivotal regulator GlnB of Escherichia coli is engaged in subtle and context-dependent control potx

... intensity of the GlnB band was quantied as the sum of the concentrations of GlnB and GlnK and was denoted by PII* Note that PII* includes the modied forms of GlnB and GlnK as well, i.e GlnBUMP and ... bars indicate the SEM The dotted line is a result of two linear regression ts of the data points The extra abscissa on top of the gure indicates...

Ngày tải lên: 23/03/2014, 04:21

17 398 0
Báo cáo khoa học: Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P Implications for metal binding and protein stability pptx

Báo cáo khoa học: Using directed evolution to improve the solubility of the C-terminal domain of Escherichia coli aminopeptidase P Implications for metal binding and protein stability pptx

... small compared with those of G270V, E406G, and R166G Changes at the surface of the protein not appear to be major contributors to the solubility of the AMPP fragments The AMPP protein appears to have ... recombinant E coli AMPP and its domain variants Creating a library for truncated AMPP fragments The 1.3 kb pepP gene encoding E coli AMPP was PCR amp...

Ngày tải lên: 23/03/2014, 07:20

10 541 0
Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

Báo cáo khoa học: Direct CIII–HflB interaction is responsible for the inhibition of the HflB (FtsH)-mediated proteolysis of Escherichia coli r32 by kCIII docx

... there is no interaction between CIII and r32 From these results, we suggest that the inhibition of r32 by CIII is due to a direct CIII HflB interaction Results In vitro proteolysis of r32 by HflB ... CIIIC on the proteolysis of r32 by HflB was also assayed in the presence of CIIIC (60 lm) instead of CIII (Fig 2B) It is clear that in this A B...

Ngày tải lên: 23/03/2014, 10:20

6 455 0
w