Technique for drawing female manga characters

A Technique for Practising Conditional Sentence1

A Technique for Practising Conditional Sentence1

... stories All types of conditionals can be practiced at the same time It is essential, however, that learners know the difference in meaning and usage of various types of conditionals Short Narrations ... wouldn't have had so much to drink If I hadn't had so much to drink, I wouldn't have started a fight If I hadn't started a fight, I wouldn't have been taken to the police station If I hadn...

Ngày tải lên: 06/09/2013, 11:10

2 286 0
Tài liệu Báo cáo khoa học: "Using Structural Information for Identifying Similar Chinese Characters" pdf

Tài liệu Báo cáo khoa học: "Using Structural Information for Identifying Similar Chinese Characters" pdf

... to input Chinese characters more efficiently The longest Cangjie code for any Chinese character contains no more than five elements In the Cangjie codes for “脛” and “徑”, we see “一 女一” for the ... same or similar pronunciations, e.g., “試場” and “市場”, if we have a machine readable lexicon that provides information about pronunciations of characters and when we ignore speci...

Ngày tải lên: 20/02/2014, 09:20

4 420 0
Tài liệu Báo cáo : Integrated Cultivation Technique for Microbial Lipid Production by Photosynthetic Microalgae and Locally Oleaginous Yeast pptx

Tài liệu Báo cáo : Integrated Cultivation Technique for Microbial Lipid Production by Photosynthetic Microalgae and Locally Oleaginous Yeast pptx

... rate of lipid production (qP, g lipid /g cells/d) was a multiple of µ and YP/X [11, 12] D Integrated Cultivation Technique for Lipid Production Microbial lipids production via integrated technique ... volumetric lipid production rate (QP) and specific rate of lipid production (qP) by cultivation with an initial urea concentration of 5g/L and 10 g/L...

Ngày tải lên: 21/02/2014, 10:20

5 516 0
Tài liệu Báo cáo khoa học: "AN INDEXING TECHNIQUE FOR IMPLEMENTING COMMAND RELATIONS" ppt

Tài liệu Báo cáo khoa học: "AN INDEXING TECHNIQUE FOR IMPLEMENTING COMMAND RELATIONS" ppt

... special cases of definitions 1.1 and 1.2 for the property of being a set of maximal projections Before I formulate the general command definition in a formal way, I will now quote some other definitions ... indp(a3 - fp(cx') ~ indp([~') (For more details see Latecki/Pinkal (1990).) An important advantage of the indexing technique is that its applicability for checking command rel...

Ngày tải lên: 22/02/2014, 10:20

6 457 0
Báo cáo " Thunderstorm forecast technique for Noi Bai Airport " potx

Báo cáo " Thunderstorm forecast technique for Noi Bai Airport " potx

... forecast threshold of 0.6 This technique is being applied for thunderstorm forecast of Noi Bai area Run RAMS model for 48h forecast Compute thunderstorm indices CAPE, SI, KI,VT Calculate maximum ... computing thunderstorm indices for 48 subsequent hours Based on the study of 20 thunderstorm indices, we have found out four suitable thunderstorm indices for forecas...

Ngày tải lên: 14/03/2014, 15:20

8 234 1
Báo cáo khoa học: "The Treegram Index An Efficient Technique for Retrieval in Linguistic Treebanks" docx

Báo cáo khoa học: "The Treegram Index An Efficient Technique for Retrieval in Linguistic Treebanks" docx

... keeps the index small but introduces another problem: A query treegram may not appear in the treegram index as it is Therefore, VENONA expands all query treegram structures at runtime; for a given ... subtree variables, the index has to contain all matching treegrams for that subtree (c) It is quite expensive to intersect the tree sets T(DB, g) for all treegrams g containe...

Ngày tải lên: 17/03/2014, 23:20

2 329 0
Novel technique for rapid detection of a-globin gene mutations and deletions pot

Novel technique for rapid detection of a-globin gene mutations and deletions pot

... Asia and southern China have high frequencies of a-thalassemia caused by a-globin gene mutations and deletions This study was designed to find an efficient and simple diagnostic test for the mutations ... carrier couples and for prenatal diagnosis of conception by couples who are both carriers of this type of gene deletion Diagnostic assays of the a-thalassemia...

Ngày tải lên: 23/03/2014, 22:20

8 559 0
Comparison between the Matrix Pencil Method and the Fourier Transform Technique for High-Resolution Spectral Estimation

Comparison between the Matrix Pencil Method and the Fourier Transform Technique for High-Resolution Spectral Estimation

... Consequently, the threshold is an indicator of the estimation limits For example, for the worst case, and for f2 f1 Å 0.070 Hz, the threshold is between 17 and 19 dB, as is shown in Fig 12; therefore ... Comparison between the inverse of the variance and the CRB for the first DOA estimate f2 f1 Å 0.090 Hz and SNR Å 17 dB The TFBMPM reaches the CRB f...

Ngày tải lên: 26/03/2014, 00:29

18 416 0
Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt

Báo cáo khoa học: "A Figure of Merit Technique for the Resolution of Non-Grammatical Ambiguity" ppt

... transposing B The figure of merit can be calculated for each of the allowed target equivalents of a multiple meaning word, and the target equivalent with the highest figure of merit selected as the most ... equivalents The figure of merit technique enabled the choice of correct equivalents for 66 out of the 76 multiple meaning words The correc...

Ngày tải lên: 30/03/2014, 17:20

5 300 0
Modern Cartooning: Essential Techniques for Drawing Today''s Popular Cartoons

Modern Cartooning: Essential Techniques for Drawing Today''s Popular Cartoons

... of Congress Cataloging-in-Publication Data Hart, Christopher Modern cartooning: essential techniques for drawing today’s popular cartoons / Christopher Hart — First Edition Includes index Cartoon ... SCHOOL The Fine Points Drawing the Characters in Their Own Scenes INDEX This is the first cartooning book specifically designed for the person who has never drawn cartoons...

Ngày tải lên: 03/04/2014, 17:48

597 569 1
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

... 18 Tateishi-Yuyama E, Matsubara H, Murohara T, Ikeda U, Shintani S, Masaki H, Amano K, Kishimoto Y, Yoshimoto K, Akashi H, Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients ... JP: Automated high-dimensional flow cytometric data analysis Proc Natl Acad Sci USA 2009, 106:8519-8524 Lo K, Brinkman RR, Gottardo R: Automated gating of flow cytometry data via robus...

Ngày tải lên: 18/06/2014, 16:20

15 476 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
báo cáo hóa học:" New fluoroscopic imaging technique for investigation of 6DOF knee kinematics during treadmill gait" pot

báo cáo hóa học:" New fluoroscopic imaging technique for investigation of 6DOF knee kinematics during treadmill gait" pot

... 5.45 ± 0.76° for the treadmill speeds of 1.5 MPH and 3.0 Discussion This paper introduced the technique of using the DFIS for measurement of 6DOF in-vivo knee kinematics during treadmill gait ... introduced the DFIS technique for measurement of 6DOF in-vivo knee kinematics during treadmill gait The technique showed feasibility to analyze the dynamic...

Ngày tải lên: 20/06/2014, 01:20

5 312 0
w