... ventilation protocols Because it is very clearly how a ventilator mode is used, not just which mode is chosen, clear descriptions of the ventilator protocols and the adherence to them are essential ... indeed to limiting enrolment to those patients with the most severe forms of ARDS [7] The potential benefits of this latter decision in terms of potential increased effe...
Ngày tải lên: 12/08/2014, 22:22
... crockery, glassware & cutlery where possible (to reduce waste) This is part of Greener Events , a guide on reducing the environmental impacts of conferences and seminars There are also companion guides ... suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager by the event mana...
Ngày tải lên: 16/03/2014, 19:20
hacking vim a cookbook to get the most out of the latest vim editor
... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali ... platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor The combination o...
Ngày tải lên: 01/06/2014, 10:43
Báo cáo y học: " Mimicking microbial ‘education’ of the immune system: a strategy to revert the epidemic trend of atopy and allergic asthma?" ppt
... ‘unhygienic’ areas inhale and ingest a different kind, variety and amount of bacteria compared with children of farmers and anthroposophic families, who have access to natural soil and eat only ... environmental antigens Facultative and professional antigen-presenting cells (dendritic cells) may be the target of a microbial bystander effect, that may dictate the pa...
Ngày tải lên: 12/08/2014, 18:20
Vcd as a stimulating factor to increase the young learners’ time-on-task
... smooth And they may learn linguistic forms naturally Hence, the task-based teaching is useful in that it creates opportunities for learners to use language as a tool rather than as an object to satisfy ... for the past few decades So many approaches and methods such as Audiolingual Method, Total Physical Response, Content-based language teaching, Theme-based language teaching...
Ngày tải lên: 07/11/2012, 14:44
báo cáo khoa học: "Feedback GAP: study protocol for a clusterrandomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary care" pdf
... this article as: Ivers et al.: Feedback GAP: study protocol for a cluster-randomized trial of goal setting and action plans to increase the effectiveness of audit and feedback interventions in primary ... feedback to explore the barriers and facilitators to Ontario family physicians’ acceptance and utilization of performance feedb...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: " A quasi-experimental test of an intervention to increase the use of thiazide-based treatment regimens for people with hypertension" docx
... announces that a deputy secretary of the Department of Veterans Affairs has stated that he will return any financial saving reaped by increased use of thiazide-based regimens to the VA medical ... led the project team, and drafted the manuscript MJK and MLJ planned and conducted all statistical analyses, and AW did the statistical programming All the authors served...
Ngày tải lên: 11/08/2014, 05:22
A systems biology approach to elucidating the frequency decoding mechanism governing differential mammalian gonadotropin subunit gene expression
... GnRH and through its intracellular mechanisms, allow the frequency of GnRH to dictate the predominance in the expression of any subunit gene A number of both theoretical and experimental approaches ... consequences of calcium release into the cytoplasm and the activation of PKCs is the firing of the three major MAPK cascades, culminating in the activation of extrace...
Ngày tải lên: 11/09/2015, 09:11
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... qualities, brand loyalty, brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of...
Ngày tải lên: 24/09/2012, 17:19
Tài liệu How To Use the Six Laws of Persuasion during a Negotiation pptx
... not only to make the sale, but also to meet the needs of their buyers Here are Cialdini’s Six Laws of Persuasion: Law of Reciprocity Human beings, in general, try to repay in kind what another person ... recognize that you are being manipulated, you can call the other side on their tactics and counter with an appropriate strategy This will lead to a more effective w...
Ngày tải lên: 21/12/2013, 04:18
Using eliciting question as a technique to teach english to 11th form pupils
... of Using eliciting questions as a technique to teach English to 11th form pupils is an attempt to provide a basic understanding about English questions and questioning techniques The advantages ... of using eliciting questions and some ways to exploit eliciting questions to teach English to 11th form pupils are also mentioned The two survey...
Ngày tải lên: 27/12/2013, 20:26
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20