AN0764 implementing temperature based variable fan speed control in NLX power supplies

Design and Simulation of Adaptive Speed Control for SMO-Based Sensorless PMSM Drive

Design and Simulation of Adaptive Speed Control for SMO-Based Sensorless PMSM Drive

... SIMULINK/MODELSIM CO -SIMULATION OF SENSORLESS SPEED CONTROL FOR PMSM DRIVE In Fig.1, it shows the sensorless speed control block diagram for PMSM drive and its Simulink/ModelSim cosimulation architecture ... work-3 of ModelSim in Fig.4 respectively performs the function of speed estimation and speed loop adaptive PI controller, the function of curre...

Ngày tải lên: 02/08/2015, 13:21

6 513 0
Tài liệu Speed Control of DC Manchines pptx

Tài liệu Speed Control of DC Manchines pptx

... Đặc tính tải Thêm Radd nối tiếp cuộn dây phần ứng Example 1: Example 2: Example 3: Đặc tính động DC kích từ nối tiếp Example 4: Example 5:

Ngày tải lên: 17/12/2013, 14:15

11 430 1
SIMULATION AND SPEED CONTROL OF  INDUCTION MOTOR DRIVES

SIMULATION AND SPEED CONTROL OF INDUCTION MOTOR DRIVES

... P a g e Simulation and Speed Control of Induction Motor Drives 2012 CHAPTER ANALYSIS OF VARIOUS METHODS FOR SPEED CONTROL OF IM The various methods of speed control of 3- Induction motor are ... Simulation and Speed Control of Induction Motor Drives 2012 Figure 3.13: Torque -Speed Characteristics for machine parameters as in Fig 3.8 13 | P...

Ngày tải lên: 18/12/2013, 22:06

76 687 0
MM420 SPEED CONTROL

MM420 SPEED CONTROL

... Status Word ACTVAL_WORD: Địa Actual Value Word ACT_ROTATION: Chiều quay thực thi CTR_WORD: Địa Control Word SETP_WORD: Địa Setpoint Word Trước hết, bạn cần cài đặt thông số biến tần thiết lập

Ngày tải lên: 28/12/2013, 22:07

2 479 3
Tài liệu Speed Control SPC GAS SPRINGS, cushioned pptx

Tài liệu Speed Control SPC GAS SPRINGS, cushioned pptx

... Speed Control « SPC Gas Springs, cushioned SPC Gas Spring 2486.12 ! CT P R S TM 2486.12 ODU FIBRO SPC Gas Springs Speed ControlTM« are designed to reduce or ... airflow Braking distance (~ 30 mm) 2486.12.05000 Speed Control « SPC Gas Springs, cushioned ! CT R S TM P 2486.12 ODU Dimensions for SPC Gas Spring 2486.12 Order no Stroke max Force in daN at ... t...

Ngày tải lên: 22/01/2014, 02:20

4 336 0
Tài liệu Mechatronics DC Motor / Tachometer Closed-Loop Speed Control System ppt

Tài liệu Mechatronics DC Motor / Tachometer Closed-Loop Speed Control System ppt

... assumptions made for the DC motor model, as the analog tachometer is a DC generator - a DC motor in reverse Mechatronics DC Motor / Tachometer Closed-Loop Speed Control System Kevin Craig 16 Mathematical ... The motor used in this system is the Honeywell 22VM51-020-5 DC Motor with Tachometer The factory specifications are shown in Table Mechatronics...

Ngày tải lên: 25/01/2014, 13:20

29 731 0
Báo cáo hóa học: " Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness" ppt

Báo cáo hóa học: " Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness" ppt

... article as: Visoottiviseth et al.: Cross-layer based adaptive wireless traffic control for per-flow and per-station fairness EURASIP Journal on Wireless Communications and Networking 2011 2011:97 Submit ... prioritized ACK scheme; WLAN-ATC: wireless LAN adaptive traffic control; WLANs: wireless local area networks; WTC: wireless traffic control Author de...

Ngày tải lên: 20/06/2014, 22:20

26 426 0
báo cáo hóa học:" Scan speed control for tapping mode SPM" docx

báo cáo hóa học:" Scan speed control for tapping mode SPM" docx

... of scan speed for tapping- mode atomic force microscopy Rev Sci Instrum 2002, 73(8):2928-2936 Kodera N, Sakashita M: Dynamic proportional-integral-differential controller for high -speed atomic force ... as experimental evidence Keywords: tapping- mode SPM; scan speed; closed-loop control Background Tapping mode is considered to be the most precise mode of the scanni...

Ngày tải lên: 21/06/2014, 17:20

10 326 0
Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

Báo cáo y học: "Association of MICA with rheumatoid arthritis independent of known HLA-DRB1 risk alleles in a family-based and a case control study" pps

... et al Table Case- control analysis in German Caucasians (a) All individuals without controlling for LD with HLA-DRB1 Minor allele Allele frequency in cases/controls Total alleles of RA cases/controls ... bioCTGTGCAGT(L)ATCTAGGCTGAAGG; and MICA- 250: AAGGTGATGGGTTCGGGAA, TCTAGCAGAATTGGAGGGAG [21], and bioCTCAGGAC(L)ACGCCGGATT For the MICA2 50 assay, a genotyping primer b...

Ngày tải lên: 09/08/2014, 14:20

11 460 0
The role of organizational research in implementing evidence-based practice: QUERI Series pot

The role of organizational research in implementing evidence-based practice: QUERI Series pot

... http://www.implementationscience.com/content/3/1/29 since QUERI' s inception, we describe the role of organizational research using a series of QUERI- specific applications We also briefly examine the contributions of organizational theory ... implementation Role of organizational factors in the QUERI model of implementation research Evaluation of the...

Ngày tải lên: 11/08/2014, 05:21

15 282 0
Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx

Báo cáo y học: "A social marketing approach to implementing evidence-based practice in VHA QUERI: the TIDES depression collaborative care model" docx

... as the underlying marketing theory and associated evaluation activities Social marketing: Applying marketing techniques to social problems Figure model of collaborative care into Effective (TIDES) ... the TIDES marketing materials, whether they felt the materials were compelling, and whether they are referring patients to TIDES depression care managers Discuss...

Ngày tải lên: 11/08/2014, 05:21

12 357 0
báo cáo khoa học: " Implementing evidence-based interventions in health care: application of the replicating effective programs framework" ppsx

báo cáo khoa học: " Implementing evidence-based interventions in health care: application of the replicating effective programs framework" ppsx

... for implementing evidence-based interventions into community-based settings through a combination of intervention "packaging ," training, technical assistance, and other strategies to maximize the ... programs framework for health care interventions Replicating effective programs framework for health care interventions This figure outlines the Replicating Eff...

Ngày tải lên: 11/08/2014, 05:22

10 313 0
w