A representation for characteristic functionals of stable random measures with values in sazonov spaces

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

Tài liệu Developing Culturally and Linguistically Competent Health Education Materials: A Guide for the State of New Jersey ppt

... Pediatric Asthma Coalition of New Jersey Sandra Fusco-Walker, Allergy & Asthma Network Mothers of Asthmatics Teresa Lampmann, Pediatric Asthma Coalition of New Jersey Guide for Developing Culturally ... Linguistically Competent Health Education Materials: A Guide for the State of New Jersey The following checklist has been developed to assist...

Ngày tải lên: 14/02/2014, 13:20

24 525 0
Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

Tài liệu Towards a framework for the study of the neural correlates of aesthetic preference pdf

... Vartanian and Goel (2004) carried out their study to “determine 382 M Nadal et al the neuroanatomical correlates of aesthetic preference for paintings” (Vartanian and Goel, 2004, p 893) Another ... former case, there is the advantage of studying reactions to real art and the disadvantage that any two works of art differ from each other in several different respects, so t...

Ngày tải lên: 19/02/2014, 17:20

19 528 0
Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc

Báo cáo khoa học: " A Tool for Error Analysis of Machine Translation Output" doc

... identify statistical machine translation errors In Proceedings of EAMT, pages 52–57, Saint Rapha¨ l, France e 61 Mary Flanagan 1994 Error classification for MT evaluation In Proceedings of AMTA, pages ... 17(1):43–75 Masaki Murata, Kiyotaka Uchimoto, Qing Ma, Toshiyuki Kanamaru, and Hitoshi Isahara 2005 Analysis of machine translation systems’ errors in tense, aspect, and m...

Ngày tải lên: 07/03/2014, 22:20

6 480 0
Báo cáo khoa học: "A System for Semantic Analysis of Chemical Compound Names" pdf

Báo cáo khoa học: "A System for Semantic Analysis of Chemical Compound Names" pdf

... number of different names and name types for one chemical compound, namely several systematic, semi-systematic, trivial and trade names For example, pentan-2-ol is the recommended name for the compound ... architecture of CLP(name2structure), a system for semantic and syntactic processing of chemical compound names In the introductory section, we described the chara...

Ngày tải lên: 08/03/2014, 01:20

9 488 0
Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf

Báo cáo khoa học: "A Framework for Customizable Generation of Hypertext Presentations" pdf

... type of specifications, each of which is optional except for the name of the exemplar: • Name: Specification of the name of the exemplar • Parameters: Specification of the arguments passed in parameters ... relation of elaboration and to specify syntactic conjunction Exemplar: [ Name: soft-description Param: [ $SOFT ] Const: [ AND [ title ( $SOFT ) paragraph-break ( ) object-t...

Ngày tải lên: 08/03/2014, 05:21

5 419 0
Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

Báo cáo khoa học: "QARLA:A Framework for the Evaluation of Text Summarization Systems" pdf

... framework Even if the test is very limited by the number of topics, it confirms the potential of the framework, with the highest KING metric combination doubling the performance of the best ROUGE ... In the rightmost part of the figure, peers are distributed around the set of models, closely surrounding them, receiving a high JACK value A Case of Study In orde...

Ngày tải lên: 17/03/2014, 05:20

10 519 0
Báo cáo khoa học: "A Model for Robust Processing of Spontaneous Speech by Integrating Viable Fragments*" ppt

Báo cáo khoa học: "A Model for Robust Processing of Spontaneous Speech by Integrating Viable Fragments*" ppt

... combination of deep and shallow processing for spontaneous speech translation In Proc Int Conf on Acoustics, Speech and Signal Processing (ICASSP), pages 71-74, Mfinchen, Germany IEEE Signal Processing ... of one parser is considered Conclusion and Outlook We have described a model for the combination of partial parsing results and how it can be applied in order to imp...

Ngày tải lên: 17/03/2014, 07:20

5 428 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
Báo cáo hóa học: " On the Krasnoselskii-type fixed point theorems for the sum of continuous and asymptotically nonexpansive mappings in Banach spaces" pptx

Báo cáo hóa học: " On the Krasnoselskii-type fixed point theorems for the sum of continuous and asymptotically nonexpansive mappings in Banach spaces" pptx

... Arunchai and Plubtieng: On the Krasnoselskii-type fixed point theorems for the sum of continuous and asymptotically nonexpansive mappings in Banach spaces Journal of Inequalities and Applications ... generalized forms of the Krasnoselskii theorem on fixed points for the sum A + B of a weakly-strongly continuous mapping and an asympt...

Ngày tải lên: 21/06/2014, 01:20

11 460 0
Báo cáo khoa học: "A Natriuretic peptide testing for the evaluation of critically ill patients with shock in the intensive care unit: a prospective cohort study" pptx

Báo cáo khoa học: "A Natriuretic peptide testing for the evaluation of critically ill patients with shock in the intensive care unit: a prospective cohort study" pptx

... for diagnosis or monitoring as part of standard care Given their value in evaluating and managing patients with heart failure, the natriuretic peptide class of biomarkers might be useful as a ... Because hemodynamic monitoring is a frequent theme in the evaluation of patients in the ICU setting, there may be logic behind evaluating ICU patients by test...

Ngày tải lên: 12/08/2014, 23:21

7 354 0
Approximate methods for fixed points of nonexpansive mappings and nonexpansive semigroups in hilbert spaces

Approximate methods for fixed points of nonexpansive mappings and nonexpansive semigroups in hilbert spaces

... basic for the development of fixed points of contraction mapping in finite dimensional spaces to many other classes of mappings, for instance Lipschitzian mappings, pseudocontractive mappings in Hilbert ... and nonexpansive semigroups in Hilbert spaces 4 Chapter Preliminaries 1.1 1.1.1 Approximative Methods For Fixed Points of Nonexpansive Mappi...

Ngày tải lên: 25/08/2015, 14:54

26 383 0
Approximation for nonsmooth functionals of stochastic differential equations with irregular drift

Approximation for nonsmooth functionals of stochastic differential equations with irregular drift

... Solution of Stochastic Differential Equations Springer [15] Kohatsu-Higa, A., Lejay, A and Yasuda, K (2012) On Weak Approximation of Stochastic Differential Equations with Discontinuous Drift Coefficient ... convergent rates of the Euler-Maruyama scheme for specific classes of stochastic differential equations with discontinuous drift The aim of the pre...

Ngày tải lên: 14/10/2015, 07:53

20 261 0
A representation for characteristic functionals of stable random measures with values in sazonov spaces

A representation for characteristic functionals of stable random measures with values in sazonov spaces

... representation for characteristic functionals of stable random measures 39 [9] A R Soltani and S Mahmoodi, Characterization of multidimensional stable random measures by means of vector measures, ... A (.) = exp{− A k(., y)µ(dy)} is a characteristic functional Let Φ (A) be an X -valued random vector with characteristic functional A representation...

Ngày tải lên: 14/11/2015, 08:03

13 307 0
w