MAGNETIC FIELD DEPENDENCE OF MAGNETIC CASIMIR EFFECT

Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"

Báo cáo y học: "Expression of Human Globular Adiponectin-Glucagon-Like Peptide-1 Analog Fusion Protein and Its Assay of Glucose-Lowering Effect In Vivo"

... Purification and refolding of N-terminal His-tagged gAd-GLP-1-A fusion protein The fusion protein was purified by High-Affinity Ni-IDA Resin After filtering, the fusion protein was bound in the column ... by improving both insulin resistance and insulin secretion deficiency However, we only observed the glucose-lowering effect of the whole fusion protein in thi...

Ngày tải lên: 25/10/2012, 11:10

7 613 0
Effect of Calcium and Magnesium Addition on Arsenic Leaching from Paddy Field Soil of Bangladesh

Effect of Calcium and Magnesium Addition on Arsenic Leaching from Paddy Field Soil of Bangladesh

... investigate the effect of Ca and Mg addition on the leaching behavior of As from highly contaminated paddy field soil under different concentrations of Ca and Mg addition, pH conditions and anaerobic ... Other Conditions 0.9 Effect of P and 100 and 2.0 pH adjusted to 3.0, 5.0, 7.0, 9.0 and 11.0 pH 7.0 Leaching in anaerobic incubation and 100 0.9 Eff...

Ngày tải lên: 05/09/2013, 10:15

10 553 0
Tài liệu Field Surveys of Office Equipment Operating Patterns ppt

Tài liệu Field Surveys of Office Equipment Operating Patterns ppt

... TWh Office equipment energy consumption has since grown to 74 TWh3 (Kawamoto et al., 2001) This growth has drawn attention to the office equipment end use As the energy impacts of office equipment ... non-business hours is an important determinant of energy use In a 9to-5 office, office equipment is used during less than 25 percent of the week For personal office equ...

Ngày tải lên: 18/02/2014, 04:20

33 200 0
Tài liệu An Aviator''''s Field Book Being the field reports of Oswald Bölcke, from August 1, 1914 to October 28, 1916 doc

Tài liệu An Aviator''''s Field Book Being the field reports of Oswald Bölcke, from August 1, 1914 to October 28, 1916 doc

... An Aviator's Field Book, by Oswald Bölcke Being the Field Reports of Oswald Bölcke, from August 1, 1914, to October 28, 1916 TRANSLATED FROM THE GERMAN BY ROBERT REYNOLD ... learned An Aviator's Field Book, by Oswald Bölcke 17 further details from Lieutenant B After landing, one of the aviators ran to the village, returned with a stretc...

Ngày tải lên: 18/02/2014, 09:20

38 565 0
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx

... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The e...

Ngày tải lên: 19/02/2014, 05:20

11 487 0
Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

Tài liệu Báo cáo Y học: Temperature dependence of thermodynamic properties for DNA/DNA and RNA/DNA duplex formation pdf

... to avoid the formation of hairpin or slipped duplex structures and to limit the base pair length less than 12 bp For any of the non-self-complementary duplex formations, the thermodynamic parameters ... DNA/DNA and 41 RNA/DNA duplexes at standard temperature (25 C) and physiological temperature (37 C) Direct comparison shows that the temperature- independent and...

Ngày tải lên: 22/02/2014, 07:20

10 449 0
Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

Báo cáo khoa học: The pH dependence of kinetic isotope effects in monoamine oxidase A indicates stabilization of the neutral amine in the enzyme–substrate complex ppt

... Isotope effects and their pH dependence in MAO A pH pH Fig (A, B) pH dependence of the steadystate kinetic parameters of MAO A- catalysed oxidation of kynuramine at 20 °C (C, D) pH dependence of the ... steady-state kinetic parameters of MAO A- catalysed oxidation of benzylamine at 20 °C Fig S2 pH dependence of the reductive half-reaction o...

Ngày tải lên: 07/03/2014, 06:20

9 328 0
Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

Báo cáo khoa học: A kinetic approach to the dependence of dissimilatory metal reduction by Shewanella oneidensis MR-1 on the outer membrane cytochromes c OmcA and OmcB potx

... CACACTGCAACCTCTGGT ACTGTCAATAGTGAAGGT CCCCATGTCGCCTTTAGT TCGCTAGAACACATTGAC ATGATGAAACGGTTCAAT TTAGTTACCGTGTGCTTC CTGCTGCTCGCAGCAAGT GTGTGATCTGCAACTGTT CACCGAGGAATAATAAATGATG AAACGGTTCAATTTC TTAGTTACCGTGTGCTTC ... TTAGTTACCGTGTGCTTC CACCGAGGAATAATAAATGATG AACGCACAAAAATCA TTACATTTTCACTTTAGT OMCA- PBAD-R OMCB- PBAD-F OMCB- PBAD-R 3736 controlled by an arabinose promoter [26], was achieved...

Ngày tải lên: 07/03/2014, 09:20

11 742 0
Báo cáo khoa học: "On the Evaluation and Comparison of Taggers: the Effect of Noise in Testing Corpora." doc

Báo cáo khoa học: "On the Evaluation and Comparison of Taggers: the Effect of Noise in Testing Corpora." doc

... a t is, if the training and test sets are extracted from the same corpus, they will probably contain the same kind of errors in the same kind of situations This may cause the training procedure ... uncertainty in the evaluation m a y be, in some cases, larger than the reported improvements from one system to another, so invalidating the conclusions of the co...

Ngày tải lên: 08/03/2014, 05:21

6 588 0
Temperature dependence of morphology and diameter of silicon nanowires synthesized by laser ablation

Temperature dependence of morphology and diameter of silicon nanowires synthesized by laser ablation

... the temperature dependence of the morphology of SiNWs synthesized by laser ablation In this Letter, we present the results on this project Our results show that the morphology and diameter of ... B, the temperature dependence of the morphology and diameter of the SiNWs is similar to that by thermal evaporation, reported recently by Peng et al [14] I...

Ngày tải lên: 16/03/2014, 15:09

5 402 0
Báo cáo hóa học: " Field Dependence of the Spin Relaxation Within a Film of Iron Oxide Nanocrystals Formed via Electrophoretic " pptx

Báo cáo hóa học: " Field Dependence of the Spin Relaxation Within a Film of Iron Oxide Nanocrystals Formed via Electrophoretic " pptx

... presence of a small external field For the ZFC data, the magnetic moment rises more rapidly and attains a greater maximum value for the field applied parallel to the film surface This implies an easy magnetization ... qualitative agreement with the theoretical model of the ZFC magnetization of weakly interacting nanoparticle assemblies proposed by Azeggagh and Kachkachi [31...

Ngày tải lên: 21/06/2014, 17:20

6 286 0
Báo cáo hóa học: " Electron-Spin Precession in Dependence of the Orientation of the External Magnetic Field" docx

Báo cáo hóa học: " Electron-Spin Precession in Dependence of the Orientation of the External Magnetic Field" docx

... study the electron-spin dynamics in dependence of the orientation (h) of the magnetic field The spin precession frequency, amplitude, and decay rate as a function of h are estimated and their dependences ... electron spin and rapidly relaxing spin of the hole Since gk and g\ are close in magnitude, the contribution from a difference in the spread of thei...

Ngày tải lên: 22/06/2014, 00:20

4 343 0
Manifestations of quantum mechanics in open systems from opto mechancis to dynamical casimir effect

Manifestations of quantum mechanics in open systems from opto mechancis to dynamical casimir effect

... MANIFESTATIONS OF QUANTUM MECHANICS IN OPEN SYSTEMS: FROM OPTO -MECHANICS TO DYNAMICAL CASIMIR EFFECT GIOVANNI VACANTI (Master in physics, Universit´ degli studi ... [44] to avoided crossing in two level quantum systems [52] In this thesis, we pursue the intriguing task of studying a genuine manifestation of quantum mechanics such as DCE in the...

Ngày tải lên: 10/09/2015, 09:10

178 246 0
Atomic number dependence of spin hall effect

Atomic number dependence of spin hall effect

... precession in spin transport 24 1.3 Objective and scope of this thesis 25 1.3.1 Atomic number dependence on spin Hall effect 25 Experimental techniques 27 2.1 ... relaxation length with coherent spin transport up to hundreds of micron [2][3] In this thesis, we study the possibility of manipulating electron spins in graphene via spin Hall effect (SHE) through meta...

Ngày tải lên: 30/09/2015, 10:11

76 214 0
w