A taxonomy based perspective of the design trade offs for bittorrent like protocols

A taxonomy based perspective of the design trade offs for bittorrent like protocols

A taxonomy based perspective of the design trade offs for bittorrent like protocols

... propose a new taxonomy- based approach for analyzing the trade- offs in a practical implementation of the BT protocol and investigate these trade- offs in the protocol design space Finally, we propose ... proposed by Fan et al 1.1 Our Approach Therefore, we propose a new taxonomy- based approach for analyzing the trade- offs that takes into consideration...

Ngày tải lên: 26/09/2015, 10:44

57 263 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt

... or gain -of- function variants of MLL1 are prime examples of the importance of maintaining the enzymatic activity of MLL1 under tight control Identifying the protein structural features that account ... association and coordinate function of the H3 K4 methyltransferase MLL1 and the H4 K16 acetyltransferase MOF Cell 121, 873–885 17 Yokoyama A, Wang Z, Wysocka J, Sa...

Ngày tải lên: 16/02/2014, 14:20

11 762 0
 A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc

 A Perception-Based View of the Employee: A Study of Employees’ Reactions to Change doc

... from the market may also restrict the nature and degree of organizational change or adaptation in organizations (Hannan and Freeman, 1984) Research on organizational change has led to various views ... On the other hand, it is probable that resistance to change may at times have a positive effect on the outcome of organizational change, and that it may be strategicall...

Ngày tải lên: 23/03/2014, 04:21

249 379 0
A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot

A Risk-based Audit of the Captive/Privately- owned Cervid Industry in Michigan pot

... List of abbreviations AB Alberta, Canada AHDL Animal Health Diagnostic Laboratory AIA Animal Industry Act AID Animal Industry Division, Michigan Department of Agriculture APHIS-VS Animal and Plant ... welfare of domestic animals in the Animal Industry Act (AIA), P .A 466 of 1988 (AIA 1988) The AIA was “intended to protect the health, safety, and welfare of humans an...

Ngày tải lên: 29/03/2014, 22:20

168 285 1
Báo cáo toán học: "A duality based proof of the Combinatorial Nullstellensatz Omran Kouba" pps

Báo cáo toán học: "A duality based proof of the Combinatorial Nullstellensatz Omran Kouba" pps

... and achieves the proof of Lemma Before proceeding with the proof of Theorem 1, let us recall that the total degree of a polynomial P from K[X1 , , Xm ] is the largest value of d1 + d2 + · · · ... Finally, the conclusion of the theorem follows since m λS11 λS22 · · · λSm P (t1 , t2 , , tm ) = Φ(P ) = t t t (t1 , ,tm )∈S1 ×···×Sm This ends the proof of Theorem Re...

Ngày tải lên: 07/08/2014, 21:21

3 266 0
Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf

Báo cáo y học: " A sequence-based survey of the complex structural organization of tumor genomes" pdf

... used AGGAAAAGGCCTTGAAGCTC and TGCTGTATTTGACAGGACAAGTG (outer primers), and GAGGACATGCTCCTACCTGTG and TGCTGTATTTGACAGGACAAGTG (inner primers) For CN272097 we used CCAACGTGAGCTTCCAGAAC and ACAGAAACGCCTCTTCTCATTTAG ... Spectrum-based classification and analysis of the fluorescent images (SKY) was achieved using SkyView™ software (Applied Spectral Imaging, Carlsbad, CA, USA) The karyotypes...

Ngày tải lên: 14/08/2014, 08:20

17 431 0
a corpus-based analysis of the collocates of the word  homeland  in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ  homeland  qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu

a corpus-based analysis of the collocates of the word homeland in the 1990s, 2000s and 2010s = nghiên cứu đồng định vị của từ homeland qua các thập niên 1990, 2000 và 2010 trên cơ sở ngôn ngữ học khối liệu

... articles The second and the third group stay the same as the second and the third group in the period of the 1990s In other words, the meaning of the word homeland in the 2000s and 2010s remained the ... that the results for the use of the word homeland collected in Time Magazine corpus be the same as that in COCA Corpus, that is th...

Ngày tải lên: 02/03/2015, 14:17

40 435 0
A student - based evaluation of the reading comprehension tasks in  Tieng Anh 12 Nang Cao  = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách

A student - based evaluation of the reading comprehension tasks in Tieng Anh 12 Nang Cao = Đánh giá của học sinh về các hoạt động đọc hiểu trong sách

... typical types of the reading tasks in Tieng Anh 12 Nang Cao are as follows Form of task Total: 53 While -reading Task - Matching words and meanings 12 - Question- answering 10 Matching Gap filling ... further macro evaluation On the other hand, micro -evaluation can be an individual, practical and legitimate way of carrying out an empirical evaluation...

Ngày tải lên: 19/03/2015, 10:34

63 912 0
Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

Consolidation Chareteristics based on a direct analytical solution of the Terzaghi Theory

... coefficient of consolidation and end of primary settlement based on a direct solution of the Terzaghi theory This new method determines the coefficient of consolidation utilizing the entire range of consolidation ... study confirms that the identification of the experimental range of primary consolidation that corresponds to the Terzaghi theo...

Ngày tải lên: 21/03/2013, 14:09

9 405 0
A capillary-based method determining the permeability of sand layer for geothermal applications

A capillary-based method determining the permeability of sand layer for geothermal applications

... role in the modelling of the heat transfer of BHEs in an aquifer for geothermal applications This paper presented a novel laboratory method determining the hydraulic permeability of sand layer using ... that, except for sand samples, the present method can also be applied for other porous materials with the grain diameter of 0.1-0.6 mm For porous...

Ngày tải lên: 05/09/2013, 17:03

8 453 0
Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

Báo cáo khoa học: "A Memory-Based Approach to the Treatment of Serial Verb Construction in Combinatory Categorial Grammar" pdf

... in registers for being filled to gaps found in the rest of the input sentence These registers are too powerful since they enable ATN to recognize the full class of context-sensitive grammars In ... goes out to seek Laay in the cane field and he finds that it is about to walk away.’ The sentence in (17) are split into two SVCs: the series of V1 to V3 and the...

Ngày tải lên: 08/03/2014, 21:20

9 573 0
THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS: A Preliminary Assessment pdf

THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS: A Preliminary Assessment pdf

... February 2002 SUMMARY THE ENVIRONMENTAL IMPACTS OF THE WORLD TRADE CENTER ATTACKS A Preliminary Assessment February 2002 SUMMARY OF FINDINGS • The terror attacks on the World Trade Center, in addition ... recommendations for government action based on our initial research and analysis CHAPTER I AN UNPRECEDENTED ENVIRONMENTAL ASSAULT THE ENVIRONMENTAL IM...

Ngày tải lên: 15/03/2014, 16:20

35 364 0
A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

A Single-Molecule Perspective on the Role of Solvent Hydrogen Bonds in Protein Folding and Chemical Reactions pptx

... bridging the A and G b-strands of the I27 protein during the main unfolding barrier.[39] To further validate this view and gain insight into the role of solvent hydrogen bonds in protein unfolding, ... separating b-strands In Figure B, we define the pulling coordinate for the A and G b-strands as the distance between the first amino acid of strand...

Ngày tải lên: 22/03/2014, 18:20

12 557 0
A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies pot

... Mag Stephan FRIEDRICH A WORLD WIDE REVIEW OF THE COMMERCIAL PRODUCTION OF BIODIESEL – A technological, economic and ecological investigation based on case studies SCHRIFTENREIHE ... to the connected database thus eliminating the need for data entry Administration of the questionnaire online offered several advantages over a paperand-pencil...

Ngày tải lên: 29/03/2014, 17:20

164 603 3
Từ khóa:
w