A sequential iterative refinement optimization method to multiple sequence alignment

A sequential iterative refinement optimization method to multiple sequence alignment

A sequential iterative refinement optimization method to multiple sequence alignment

... Progressive alignment: Align following the guide tree PDAVMGN PGAVMGN HGS HGS EAEMKAS ADQLKKS VP?QNN PEEKSAVTALWGKV GEEKAAVLALWDKV PADKTNVKAAWGK V AADKTNVKAAWSKV EGEWQLVLHVWAKV AAEKTKIRSAWAPV ESQAALVKSSWEEF ... PKVKAHGKKVLGAFSDG L PKVKAHGKKVLHSFGEGV AQVKGHGKKVADALTNAV AQVKAHGKKVGHALTLAV EDLKKHGVTVLTALGAIL ADVRWHAERIINAVNDAV PELQAHAGKVFKLVYEAA LGNVLVCVLAHH LGNVLVVVLARH LSHCLLVTLAAH LSHCLLSTLA...

Ngày tải lên: 26/09/2015, 09:48

127 160 0
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc

... ggtagccatatgagcgaagaaataaatgaa gcgcggatcctcaagttgtgtataaata SEG AF064773 tgtgcatatgcaacccgatcctaaatta gcgcggatcctcagtgagtattaaga SEI AF285760 tgctctcgaggatattggtgtaggtaac cgcgctcgagttagttactatctacata ... SElM AF285760 cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgc...

Ngày tải lên: 18/06/2014, 16:20

9 569 0
Báo cáo hóa học: " Research Article A Combined PMHT and IMM Approach to Multiple-Point Target Tracking in Infrared Image Sequence" pdf

Báo cáo hóa học: " Research Article A Combined PMHT and IMM Approach to Multiple-Point Target Tracking in Infrared Image Sequence" pdf

... sequence of infrared images by combining the PMHT and the IMM approaches [23] In this combined approach, PMHT is first used to compute the measurement -to- target assignment probabilities and to update ... M. -A Simard, and E Shahbazian, “Come parison of various schema of filter adaptivity for the tracking of maneuvering targets,” in Signal and Data Processing of...

Ngày tải lên: 22/06/2014, 19:20

14 568 0
Báo cáo sinh học    alignminer  a web based tool for detection of divergent regions in multiple sequence alignments of c

Báo cáo sinh học alignminer a web based tool for detection of divergent regions in multiple sequence alignments of c

... Plant Plant Arabidopsis thaliana AtGS1 isoform AY088312 Arabidopsis thaliana Arabidopsis thaliana AtGS1 isoform AtGS1 isoform AY059932 AK118005 AC# (amino acid) Q56WN1 70% Q9LVI8 Plant Oryza sativa ... results can be inspected graphically via an innovative, interactive graphical interface developed in AJAX, or saved in any of several formats Implementation Architecture AlignMiner is...

Ngày tải lên: 20/12/2015, 08:16

16 292 0
Báo cáo sinh học: "Multiple sequence alignment with user-defined anchor points" pptx

Báo cáo sinh học: "Multiple sequence alignment with user-defined anchor points" pptx

... core block in sequence with the corresponding position in sequence 2, another anchor connecting sequence with sequence and a third anchor connecting sequence with sequence Although our anchor points ... [38]) Anchored and non-anchored alignment of a set of protein sequences with known 3D structure (data set lr69 from BAliBASE Anchored and non-anchored alignment o...

Ngày tải lên: 12/08/2014, 17:20

12 262 0
Báo cáo sinh học: "DIALIGN-TX: greedy and progressive approaches for segment-based multiple sequence alignment" doc

Báo cáo sinh học: "DIALIGN-TX: greedy and progressive approaches for segment-based multiple sequence alignment" doc

... otherwise non-related sequence pair, see [16] for details 2.1 Combining segment-based greedy and progressive alignment To overcome the difficulties of a 'direct' greedy algorithm for multiple alignment, ... L-INSi and E-INSi [21,22] We performed benchmarks for DNA as well as for protein alignment As globally related benchmark sets we used BRAliBase II [36,37] for RNA...

Ngày tải lên: 12/08/2014, 17:20

11 335 0
Báo cáo sinh học: "Noisy: Identification of problematic columns in multiple sequence alignments" pps

Báo cáo sinh học: "Noisy: Identification of problematic columns in multiple sequence alignments" pps

... Depending on the method, in the worst case they present a misleading signal (as in the case of parsimony methods), at best they increase the noise in the data (as in most distancebased methods) In ... be obtained in various ways In the quartet-mapping approach [20] for example, one starts with an alignment of four sequences and defines the weight of a given quartet to be t...

Ngày tải lên: 12/08/2014, 17:20

10 285 0
Báo cáo sinh học: "Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions" doc

Báo cáo sinh học: "Hierarchical folding of multiple sequence alignments for the prediction of structures and RNA-RNA interactions" doc

... ∪ σint to denote the partition of the base pairs of the first sequence, σ1, the base pairs of the second sequence, σ2, and the interacting base pairs, σint Furthermore, for the partial structure ... with the same ability The time complexity is in the magnitude of PET-fold for the added sequence length L of both alignments, and it is linear with res...

Ngày tải lên: 12/08/2014, 17:20

13 216 0
báo cáo hóa học:" Research Article A General Iterative Approach to Variational Inequality Problems and Optimization Problems Jong Soo Jung" ppt

báo cáo hóa học:" Research Article A General Iterative Approach to Variational Inequality Problems and Optimization Problems Jong Soo Jung" ppt

... of variational inequalities for monotone operators in Hilbert space,” Journal of Mathematical Analysis and Applications, vol 61, no 1, pp 159–164, 1977 J.-L Lions and G Stampacchia, Variational ... Journal of Mathematical Analysis and Applications, vol 334, no 2, pp 1450–1461, 2007 H Iiduka, W Takahashi, and M Toyoda, “Approximation of solutions of variational inequalities for mo...

Ngày tải lên: 21/06/2014, 11:20

20 367 0
Báo cáo khoa hoc:" A method to optimize selection on multiple identified quantitative trait loci" docx

Báo cáo khoa hoc:" A method to optimize selection on multiple identified quantitative trait loci" docx

... effect aA + aB aA + dB dA + aB dA + dB aA + dB aA − aB dA + dB dA − aB dA + aB dA + dB −aA + aB −aA + dB dA + dB dA − aB −aA + dB −aA − aB BV t Mean polygenic breeding value As,1,t + Ad,1,t As,1,t ... optimization problem Manfredi et al [15] used a sequential quadratic programming package to optimize selection and mating with an identified QTL for a sex-limited trait as a gener...

Ngày tải lên: 09/08/2014, 18:21

26 205 0
Báo cáo y học: "Applying the quality improvement collaborative method to process redesign: a multiple case study" doc

Báo cáo y học: "Applying the quality improvement collaborative method to process redesign: a multiple case study" doc

... Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Figure Testing and implementing ... - Gastroenterology; Surgery; Radiology; Anaesthesiology; Oncology (2) Head- and neck cancer 650 E + + + Ear, Nose and Throat; Radiology; Jaw surgery; Radiotherapy; Oncology; Pathology;...

Ngày tải lên: 11/08/2014, 05:21

11 326 0
báo cáo khoa học: " Applying the quality improvement collaborative method to process redesign: a multiple case study" pot

báo cáo khoa học: " Applying the quality improvement collaborative method to process redesign: a multiple case study" pot

... Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Part a, Idea Part b, Idea Part c, Idea Part d, Idea Idea Figure Testing and implementing ... with these data (December 2007) All gathered information was used to describe the collaborative process and to assess the applicability of the QIC method to process...

Ngày tải lên: 11/08/2014, 16:20

11 278 0
Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

Exact modeling of multiple access interference, ber derivation and a method to improve the performance of UWB communication systems

... Niranjayan, A Nallanathan and B Kannan, Modeling of Multiple Access Interference and BER Derivation for TH and DS UWB Multiple Access Systems , IEEE Transactions on Wireless communications, Aug ... Schemes”, Proc of Joint UWBST and IWUWBS 2004, May 2004 [3] S Niranjayan, A Nallanathan and B Kannan, A New Analytical Method for Exact Bit Error Rate Computa...

Ngày tải lên: 05/10/2015, 22:04

104 423 0
Development of a method to measure consumer emotions associated with foods

Development of a method to measure consumer emotions associated with foods

... Identify appropriate terms to measure emotions associated with foods maximizing information about the product Identify scaling approaches to measure emotions with consumers Develop a test protocol to ... included approximately equal percentages of males and females, and the age range was from 18 to 65 years of age Basically consumers are screened and recruited vi...

Ngày tải lên: 03/04/2013, 21:07

10 784 3
w