A proteomic approach for the identification of HCC serum biomarkers

A proteomic approach for the identification of HCC serum biomarkers

A proteomic approach for the identification of HCC serum biomarkers

... Tanaka et al., 2006; Twu et al., 1993) ; and upregulating amongst other signaling pathways, the Ras-Raf-MAPK signal transduction pathway, the JAK/STAT pathway and the protein kinase B pathway ... presentation of HCC, where the dearth of symptoms at the early stage of the disease results in detection of cancer only when at an advanced stage (Usatoff and Habib, 2002) Anothe...

Ngày tải lên: 26/09/2015, 09:47

143 270 0
Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

Báo cáo y học: "A systematic approach for the identification of novel, serologically reactive recombinant Varicella-Zoster Virus (VZV) antigens" ppsx

... present a systematic approach for the identification of novel, serologically reactive markers of infection (in this case: VZV) The knowledge about the VZV serostatus is extraordinarily important for ... Pinto et al.: A systematic approach for the identification of novel, serologically reactive recombinant VaricellaZoster Virus (VZV) antigens...

Ngày tải lên: 12/08/2014, 04:20

9 752 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...

Ngày tải lên: 18/06/2014, 15:20

9 778 0
Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

Báo cáo khoa học: "A multidisciplinary approach for the treatment of GIST liver metastasis" docx

... knowledge, represents the first in the literature describing a multidisciplinary approach for the successful management of a large metastasic GIST to the liver We attribute the success of this case to ... dilatation of the intrahepatic biliary radicals in the right lobe liver was performed, with placement of a right biliary drainage catheter for decompressi...

Ngày tải lên: 09/08/2014, 07:21

4 458 0
Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

Báo cáo y học: "A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA" doc

... as: D’Onofrio and An: A comparative approach for the investigation of biological information processing: An examination of the structure and function of computer hard drives and DNA Theoretical ... of the initial concept for comparative analysis between the DHD and CHD and and drafted the initial version of the manuscript GA dra...

Ngày tải lên: 13/08/2014, 16:20

29 430 0
Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

Báo cáo y học: " A statistical model for the identification of genes governing the incidence of cancer with age" pptx

... not performed because no real data are presently available A B 8 Number of clones Number of clones AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted ... Aa fitted aa actual aa fitted 3 2 1 Time C 8 D 12 12 AA actual AA fitted Aa actual Aa fitted aa actual aa fitted AA actual AA fitted Aa actual Aa fitted aa actual aa fitted 10 Number of...

Ngày tải lên: 13/08/2014, 16:21

9 373 0
Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

Báo cáo sinh học: "Therapeutic dendritic cell vaccine preparation using tumor RNA transfection: A promising approach for the treatment of prostate cancer" pps

... very small prostate tumors This, in association with radical prostatectomy and radiation therapies, has contributed to increasing the curative indexes [2] After several years of primary therapy, ... significant clinical benefits like disease stability in 80% of patients after 2–3 doses of vaccine The mean survival rate was 13 months for melanoma patients and months for renal...

Ngày tải lên: 14/08/2014, 19:22

7 365 0
Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

Tài liệu Báo cáo khoa học: A systems biology approach for the analysis of carbohydrate dynamics during acclimation to low temperature in Arabidopsis thaliana doc

... identification and simulation A mathematical model was developed, representing central carbohydrate metabolism in leaves of A thaliana The model was based on the following system of ordinary differential ... in A thaliana A D B E C F Fig Maximum activities of enzymes in central carbohydrate metabolism during cold exposure (A C) Vmax values of three invertase...

Ngày tải lên: 14/02/2014, 22:20

13 711 0
Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

Báo cáo khoa học: "A Unified Statistical Model for the Identification of English BaseNP" pptx

... conclusions The statistical approach In this section, we will describe the two-pass statistical model, parameters training and Viterbi algorithm for the search of the best sequences of POS tagging ... one of the N-best POS tagging result of the sentence is: T = NN VBD RB CD NNS NN NN For this POS sequence, the 2nd pass will try to determine the baseNPs as show...

Ngày tải lên: 08/03/2014, 05:20

8 484 0
Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc

Báo cáo khoa học: "A machine-learning approach to the identification of WH gaps" doc

... Illustration of the path a classifier must trace in order to identify the location of the gap from Figure At the top level, it must choose to recurse into the SQ node, and at the second level, into the ... downward from there, eventually predicting the location of the gap At each node we encounter, the classifier chooses either to recurse into one of the ch...

Ngày tải lên: 24/03/2014, 03:20

4 615 0
Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

Báo cáo khoa học: "A Clustering Approach for the Nearly Unsupervised Recognition of Nonliteral Language" pdf

... first find the results of the core algorithm and then determine the effects of each enhancement The results are shown in Figure The last column in the graph shows the average across all the target ... Supertagging: an approach to almost parsing Comput Linguist 25, (Jun 1999), 237-265 Julia Birke 2005 A Clustering Approach for the Unsupervised Recognition of...

Ngày tải lên: 24/03/2014, 03:20

8 448 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

Báo cáo hóa học: " A rapid, convenient, solventless green approach for the synthesis of oximes using grindstone chemistry" docx

... Surface area of the catalyst before and after use in the reaction was measured using surface area & pore size analyzer (NOVA 1000e, Quanta chrome Instruments) All the chemicals were used as-received ... [6], amines [7], and synthesis of azaheterocycles [8] are some of the synthetic applications of oximes They are also useful for selective a- activation [9] and are ext...

Ngày tải lên: 20/06/2014, 22:20

6 592 1
Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx

Báo cáo hóa học: "Research Article A Novel Semiblind Signal Extraction Approach for the Removal of Eye-Blink Artifact from EEGs" potx

... Nazarpour, S Sanei, and J A Chambers, A novel semiblind signal extraction approach incorporating PARAFAC for the removal of the removal of eye-blink artifact from EEGs,” in Proceedings of the ... clean signals coming from nonfrontal areas 3.3 Performance evaluations In order to provide a quantitative measure of performance for the proposed artif...

Ngày tải lên: 21/06/2014, 22:20

12 430 0
w