Role of oestrogens in male erectile function 1

Role of oestrogens in male erectile function 1

Role of oestrogens in male erectile function 1

... dysfunction should be routinely considered in the evaluation of male infertility (Berg, 19 98) The role of oestrogen in male sexual behaviour is still unknown Since the initial clinical report of ... phytoestrogen intake In addition to the scientific understanding of the mechanism of the role of oestrogens in male erectile function, the models established m...

Ngày tải lên: 17/09/2015, 17:21

53 201 0
Role of oestrogens in male erectile function 4

Role of oestrogens in male erectile function 4

... Table 14: Causes of Erectile Dysfunction in 30 Patients Indicates precipitating factors delineated for erectile dysfunction (ED) in a group of 30 patients from their presenting history (in addition ... component of the blood vessels The most convincing evidence for the role of prostaglandins in erectile function is the fact that intracavernosal injection of PGE1 is...

Ngày tải lên: 17/09/2015, 17:20

38 93 0
Role of oestrogens in male erectile function 3

Role of oestrogens in male erectile function 3

... were incubated with 3. 5µM of atropine and 5.1µM of guanethidine for 30 minutes in order to block the contractile cholinergic and adrenergic responses and to unmask the relaxant response 6.2 .3. 4 Incubation ... leading to further declines in androgen Taking into consideration the prospects of physiological and pharmacological actions of oestrogens in males and the report o...

Ngày tải lên: 17/09/2015, 17:21

57 141 0
Role of oestrogens in male erectile function 2

Role of oestrogens in male erectile function 2

... that the oestrogenic influence on the male brain is somewhat more than its role in the female brain at that stage of development since in the female foetus, circulating E2 levels are significantly ... 5.3 .2 Short-Term Treatment Groups The baseline intracavernosal pressure recorded in the control group of rats was 22 .2 2. 1 mm Hg, which was midway between the baseline pressur...

Ngày tải lên: 17/09/2015, 17:21

54 112 0
Báo cáo khoa học: Expression and physiological role of CCN4⁄Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes potx

Báo cáo khoa học: Expression and physiological role of CCN4⁄Wnt-induced secreted protein 1 mRNA splicing variants in chondrocytes potx

... WISP1 mRNA and WISP1v proteins As a result, positive signals representing fulllength CCN4 ⁄ WISP1 mRNA and WISP1v were Finally, the biological function of WISP1v and WISP1vx was evaluated using ... stage-dependent expression of WISP1v in vitro Effect of overexpression of CCN4/WISP1 and its variants on the phenotypes of human chondrocytic HCS-2 ⁄ cells Fig Immunohis...

Ngày tải lên: 07/03/2014, 10:20

11 437 0
Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot

Báo cáo khoa học: Cytoskeleton-modulating effectors of enteropathogenic and enterohemorrhagicEscherichia coli: role of EspL2 in adherence and an alternative pathway for modulating cytoskeleton through Annexin A2 function pot

... 1) An in vitro assay for the actin bundling activity of Annexin A2 clearly indicated enhancement of Annexin A2 activity in the presence of EspL2 protein [8] Furthermore, depletion of Annexin A2 ... filopodia Modification of activity of Annexin A2 by EspL2 Annexins are a family of proteins that bind to membrane phospholipids in a Ca2+-dependent manner...

Ngày tải lên: 29/03/2014, 09:20

6 273 0
Báo cáo y học: "IV among pregnant women in Moshi Tanzania: the role of sexual behavior, male partner characteristics and sexually transmitted infections" pot

Báo cáo y học: "IV among pregnant women in Moshi Tanzania: the role of sexual behavior, male partner characteristics and sexually transmitted infections" pot

... problem among women of reproductive age The behavior and other characteristics of the male partners in this study were important predictors for HIV in women Therefore, involvement of men in HIV ... encouraged to inform their partners and bring them for counseling and testing, and those with proven sexually transmitted infections were given a contact card...

Ngày tải lên: 10/08/2014, 05:20

10 434 0
Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

Báo cáo y học: " The role of polymorphisms in ADAM33, a disintegrin and metalloprotease 33, in childhood asthma and lung function in two German populations" doc

... ACGTTGGATGAGTCGGTAGCAACACCAGG rev ACGTTGGATGACCATGACACCTTCCTGCTG fwd ACGTTGGATGGGAGTGAAAAGATGTGCTGG rev ACGTTGGATGCCACTTCCTCTGCACAAATC fwd ACGTTGGATGAGAGAACTGGGTTAAGGCAG rev ACGTTGGATGCCAGCACATCTTTTCACTCC ... ACGTTGGATGAAAATACTGGGACTCGAGGC rev ACGTTGGATGTGCTGTATCTATAGCCCTCC fwd ACGTTGGATGGGGCACCAATTAACTAAGGC rev ACGTTGGATGTGAGGGCATGGAAGGTTCAG fwd ACGTTGGATGAGTCGGTAGCAACACCAGGC rev ACGTTGGATGA...

Ngày tải lên: 12/08/2014, 16:20

12 358 0
Báo cáo y học: "Unraveling the role of high mobility group box protein 1 in severe traum" doc

Báo cáo y học: "Unraveling the role of high mobility group box protein 1 in severe traum" doc

... Pittet J-F: Early release of high mobility group box nuclear protein after severe trauma in humans: role of injury severity and tissue hypoperfusion Crit Care 2009, 13 :R174 Peltz ED, Moore EE, ... Maruyama K, Abe Y, Uemoto S, Yamada S, Maruyama I: Plasma concentrations and importance of High Mobility Group Box protein in the prognosis of organ failure...

Ngày tải lên: 13/08/2014, 19:20

2 223 0
 Circuit theory of finance and the role of incentives in financial sector reform

Circuit theory of finance and the role of incentives in financial sector reform

... illustrates the main structural, theoretical and incentive-related policy implications of circuit theory of finance Section I.2 discusses the special role of the financial system as the core of the circuit ... profitability is declining The internalization of information within the same institution may thus enhance intra -circuit and inter -circuit st...

Ngày tải lên: 24/10/2012, 09:33

55 673 0
The role of language in adult education and poverty reduction in Botswan

The role of language in adult education and poverty reduction in Botswan

... program in Botswana maintains the hegemony and the gap between the poor and the rich, the major and minority groups In order to redress poverty the adult education program needs to be aware of the social ... vital in fighting poverty The adult education program can thus harness the local languages and indigenous knowledge of the minority and...

Ngày tải lên: 05/11/2012, 16:27

5 841 1
The role of advertising in society

The role of advertising in society

... categories of business-to-business advertising are industrial and professional advertising b.1 Industrial advertising Advertising targeted at individuals who buy or influence the purchase of industrial ... Index Introduction Part I : General knowledge of advertising Some typical concepts of advertising Classifications of advertising Part II : The role of adverti...

Ngày tải lên: 16/04/2013, 11:05

27 1,1K 1
Tài liệu Improving health, connecting people: the role of ICTs in the health sector of developing countries ppt

Tài liệu Improving health, connecting people: the role of ICTs in the health sector of developing countries ppt

... are involved in the effective use of ICTs in the health sector Section explores potential and actual use of ICTs in the health sector It examines the ways in which ICTs can help to strengthen ... critical in ensuring the effective use of ICTs in the health sector Programme designs should consider the role of the intermediary at the s...

Ngày tải lên: 14/02/2014, 09:20

65 662 0
w