Identification and characterization of proteins that interact with zonula occludens proteins

Identification and characterization of proteins that interact with zonula occludens proteins

Identification and characterization of proteins that interact with zonula occludens proteins

... IDENTIFICATION AND CHARACTERIZATION OF PROTEINS THAT INTERACT WITH ZONULA OCCLUDENS PROTEINS P JAYA KAUSALYA (B.Sc (Hons.), NUS) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... in TJ that are part of MAGUK family Fig 13: Structure of PDZ3 domain of PSD-95 with a peptide ligand Fig 14: Possible modes of interaction of PDZ containing protei...

Ngày tải lên: 16/09/2015, 08:31

223 383 0
Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides

Identification and characterization of novel proteins from a rare australian elapid snake drysdalia coronoides

... Bibliography 195 Appendix 224 Publications 238 vi Summary Identification and characterization of novel proteins from a rare Australian elapid snake Drysdalia coronoides Partial transcriptome from ... venomous terrestrial snakes of the Elapidae family have undergone an extensive radiation in Australia [12] Elapid snake genus Drysdalia from southern Austr...

Ngày tải lên: 11/09/2015, 10:02

268 407 0
Identification and characterization of svp interacting proteins of short vegetative phase in arabidopsis thaliana

Identification and characterization of svp interacting proteins of short vegetative phase in arabidopsis thaliana

... function of most of the J-domain proteins remains to be elucidated The function of several known J-domain proteins will be discussed in detail in section 1.5 29 1.5 Function of J-domain proteins during ... J-domain proteins in the Arabidopsis genome (Rajan and D'Silva, 2009) These J-domain proteins are classified into four distinct groups Type I J-domain proteins...

Ngày tải lên: 11/09/2015, 10:02

216 336 0
Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

Identification and characterization of a candida albicans alpha 1,2 mannosyltransferase CaMNN5 that suppresses the iron dependent growth defect of saccharomyces cerevisiae aft1 delta mutant

... 5′ GTGATTACGAAAAAGCATTTTGTGAAAAGGTTTTACC 3′ 5′ GGTAAAACCTTTTCACAAAATGCTTTTTCGTAATCAC 3′ E58 8A: 5′ GAAATGGTTGAAGGCAACAGCTGAAATTCCTACAGTAG 3′ 5′ CTACTGTAGGAATTTCAGCTGTTGCCTTCAACCATTTC 3′ The following ... CATTACTTGTTTGAAGGAATTTTGTGAAGCTGTTGTCTTCG 3' M2-R: 5' CGAAGACAACAGCTTCACAAAATTCCTTCAAACAAGTAATG 3' M3-F: 5' CATTACTTGTTTGAAGGAAACTGCAGAAGCTGTTGTCTTCG 3' M3-R: 5' CGAAGACAACAGCTTCTGCAGTTTCCT...

Ngày tải lên: 16/09/2015, 08:30

124 400 0
Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

Báo cáo Y học: Identification and characterization of thioredoxin and thioredoxin reductase fromAeropyrum pernixK1 pdf

... transhydrogenase assay described by Gan et al [25] Cloning of the two genes from A pernix K1 Thioredoxin reductase activity assays Assays for thioredoxin reductase activity were carried out by two ... 2002 Thioredoxin system of Aeropyrum pernix (Eur J Biochem 269) 5425 Thioredoxin activity assays RESULTS Thioredoxin activity was determined by the insulin precipitation assay...

Ngày tải lên: 23/03/2014, 21:20

8 415 0
Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

Báo cáo sinh học: " CODEHOP-mediated PCR – A powerful technique for the identification and characterization of viral genomes" pptx

... TTTGACCTGGAGACTATGttymgngartayaa ACCTTCATCAAAAATCCCttnggnggnatgyt GACGACCGCAGCGTGTGCGTGaaygtnttyggnca TAAAAGTACAGCTCCTGCCCGaanacrttnacrca TTAGCTACTCCGTGGAGCagyttrtcraarta GAAGTGGCAGTTGGAGAGGCTGACCTCCcartcncc ... GTGGTCGATTTTGCCAGCCTGTACCCGAGCATCATCCAGGCGCACAACCTGTGC GTAGTAGACTTTGCTAGCCTGTATCCTAGTATTATACAAGCTCATAATCTATGC GTGGTGGACTTTGCCAGCCTGTACCCCACCATCATCCAGGCCCACAACCTCTGC GTAGTGGACTTTGCCAGC...

Ngày tải lên: 18/06/2014, 22:20

24 605 0
báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

báo cáo hóa học:" Identification and characterization of a spontaneous ovarian carcinoma in Lewis rats" docx

... of proband Intraperitoneal tumor arising spontaneously in a Lewis rat has pathologic appearance of an ovarian adenocarcinoma (A) Proband shows tumor of the left ovary and intraperitoneal tumor ... D, Atkins L, Kato DT, Buczek-Thomas J, Fuller AF Jr, Hasan T: Characterization of a xenograft model of human ovarian carcinoma which produces intraperitoneal carcinomatos...

Ngày tải lên: 20/06/2014, 07:20

8 441 0
Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

Báo cáo hóa học: " Identification and characterization of alkaline serine protease from goat skin surface metagenome" docx

... al.: Identification and characterization of alkaline serine protease from goat skin surface metagenome AMB Express 2011 1:3 Submit your manuscript to a journal and benefit from: Convenient online ... and Gly-Thr-SerMet-Ala-X-Pro, which is characteristic of serine subfamily S8A Results from the sequence analysis of this protease suggested it to be serine...

Ngày tải lên: 21/06/2014, 05:20

10 426 0
Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

Báo cáo sinh học: "Small-molecule modulators of Hedgehog signaling: identification and characterization of Smoothened agonists and antagonists." pps

... approach of identifying and studying the mechanism of action of small-molecule agonists (and antagonists), we hoped to uncover some of the complexities of the Hh-signaling system Small-molecule modulators ... activation with a Hh-protein ligand has therapeutic value [49,50] On the basis of our current understanding of these models and the specific mechanism of action...

Ngày tải lên: 06/08/2014, 18:20

19 322 0
Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

Báo cáo y học: "Identification and characterization of the carboxy-terminal region of Sip-1, a novel autoantigen in Behçet''''s disease" docx

... the protein Sip1 Sip1 is a nuclear splicing factor containing an arginine/serine-rich domain and a RNAbinding motif that may play a role in linking the processes of transcription and pre-mRNA ... participated in the design and revision of the study and performed the statistical analysis RP participated in the design and revision of the study AS partic...

Ngày tải lên: 09/08/2014, 08:22

8 552 0
Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

Báo cáo y học: "The identification and characterization of a novel protein, c19orf10, in the synovium" docx

... staining (g) Intense staining of a hyperplastic RA synovial lining cell layer This staining was typical of most areas of RA synovium where the lining was hyperplastic (h) An area of an RA synovial ... stained positively (arrow) (e) Intense staining of individual cells in the lining layer of a typical OA synovium (f) An area of an OA synovium demonstrates a lining lay...

Ngày tải lên: 09/08/2014, 10:20

9 493 0
báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

báo cáo khoa học: " Identification and characterization of the Nonrace specific Disease Resistance 1 (NDR1) orthologous protein in coffee" doc

... 11 9 11 9 11 8 11 6 11 7 11 9 92 12 6 15 1 14 2 11 8 11 8 11 3 11 2 14 2 14 0 16 6 PFYQGHKN Figure The two coffee candidates for NDR1 protein belong to the NHL family Putative Arabidopsis orthologs of CaNDR1a/b ... Biology 2 011 , 11 :14 4 http://www.biomedcentral.com /14 71- 2229 /11 /14 4 (a) CE (b) 12 0 Page 10 of 17 μ PM PMA2 86 NDR1 47 34 (c) (μg) 10 15 PM...

Ngày tải lên: 11/08/2014, 11:21

17 455 0
w