Analysis of dose response data from developmental toxicity studies

Analysis of dose response data from developmental toxicity studies

Analysis of dose response data from developmental toxicity studies

... ANALYSIS OF DOSE- RESPONSE DATA FROM DEVELOPMENTAL TOXICITY STUDIES PANG ZHEN (Master of Science, Beijing University of Technology) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... saturated model to analyze the dose- response data from developmental toxicity studies Data from different dose groups are linked by the kernel weight In this...

Ngày tải lên: 15/09/2015, 22:03

107 124 0
báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

báo cáo khoa học: " Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin proteins that may play different functional roles in flour" ppt

... this article as: Altenbach et al.: Analysis of expressed sequence tags from a single wheat cultivar facilitates interpretation of tandem mass spectrometry data and discrimination of gamma gliadin ... the gamma gliadin protein families and sequence redundancy within the databases, peptide data were further inspected manually For each protei...

Ngày tải lên: 12/08/2014, 03:21

14 325 0
A discourse analysis of english economics reports from VOA = phân tích diễn ngôn các bản báo cáo kinh tế từ VOA

A discourse analysis of english economics reports from VOA = phân tích diễn ngôn các bản báo cáo kinh tế từ VOA

... in teaching and learning English 3.2.1 Application of Discourse Analysis to Teaching Grammar To enable teaching more naturally the usage of the target language as well as source language, discourse ... form an integral part of that particular industry Chapter II: A Discourse analysis economics reports from VOA 2.1 General Information about Material Selected 21 of...

Ngày tải lên: 14/12/2013, 00:41

58 1K 8
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc

... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...

Ngày tải lên: 16/03/2014, 00:20

9 491 0
Tuberculosis in Liver Transplant Recipients: A Systematic Review and Meta-Analysis of Individual Patient Data doc

Tuberculosis in Liver Transplant Recipients: A Systematic Review and Meta-Analysis of Individual Patient Data doc

... Gultekin SH, Liu B, Zhang DY Intracranial tuberculoma in a liver transplant patient: first reported case and review of the literature Am J Transplant 2003;3:88-93 Al-Moamary MS, Al-Baz S, Alothman A, ... Sepulveda A, Oliveira AC, Bacchella T, Machado MCC, Abdala E Tuberculosis in liver transplant recipients [abstract] World Transplant Congress 2006 Poster Abstracts...

Ngày tải lên: 29/03/2014, 03:20

13 531 0
báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

báo cáo hóa học:" Comprehensive molecular etiology analysis of nonsyndromic hearing impairment from typical areas in China" doc

... tRNAser(UCN), in 284 patients with early-onset, nonsyndromic hearing impairment from unrelated families from two typical Chinese areas, Chifeng City in northern China and Nantong City in southern China, ... considered the first step in genetic testing of deaf Chinese patients Furthermore, the molecular defects of about 66% of the patients with nonsyndromic hear...

Ngày tải lên: 18/06/2014, 15:20

12 511 0
Báo cáo hóa học: " Research Article Statistical Analysis of Hyper-Spectral Data: A Non-Gaussian Approach" pot

Báo cáo hóa học: " Research Article Statistical Analysis of Hyper-Spectral Data: A Non-Gaussian Approach" pot

... the statistical behavior of each background class in real hyper-spectral images has been investigated The availability of statistical models that properly describe hyper-spectral data variability ... as possible and that only have a few parameters For these reasons in our analysis, we considered two classes of mixture models that have few parameters and that are characterized...

Ngày tải lên: 22/06/2014, 23:20

10 336 0
Báo cáo hóa học: " Research Article Localized Spectral Analysis of Fluctuating Power Generation from Solar Energy Systems" docx

Báo cáo hóa học: " Research Article Localized Spectral Analysis of Fluctuating Power Generation from Solar Energy Systems" docx

... obvious lack of second-order autocorrelation in time series of the clearness index The proposed analysis of short fluctuations in solar irradiance by means of localized spectral analysis can combine ... square of solar power over the time of persistence and not the integrated solar power Here, c fe has mainly been developed for reasons of completeness but it wil...

Ngày tải lên: 22/06/2014, 23:20

8 349 0
Aircraft Flight Dynamics Robert F. Stengel Lecture13 Analysis of Time Response

Aircraft Flight Dynamics Robert F. Stengel Lecture13 Analysis of Time Response

... Determine experimentally from time response or " !  Compute the Bode plot of the system s transfer functions (TBD)! Next Time: Root Locus Analysis Reading Flight Dynamics, 357-361, 465-467, 488-490, ... , * ) , * ) , Step input : Model of Dynamics and Speed Control " where"   λ = –C/J = eigenvalue or root of the system (rad/s)"   τ = J/C = time constant of the response...

Ngày tải lên: 04/07/2014, 19:26

12 266 0
Báo cáo lâm nghiệp: "Environmental risk assessment based on semi-quantitative analysis of forest management data" pptx

Báo cáo lâm nghiệp: "Environmental risk assessment based on semi-quantitative analysis of forest management data" pptx

... provide profound information for knowledge -based forest management While recognizing the aforementioned limitations, the proposed system based on the quantification of qualitative forest management ... DISCUSSION The developed regression models can be considered as standalone complex models of environmental risk prediction allowing the “chance and potency” analysis using...

Ngày tải lên: 07/08/2014, 10:21

7 387 0
Báo cáo khoa học: "Variable number tandem repeat analysis of Mycobacterium bovis isolates from Gyeonggi-do, Korea" ppt

Báo cáo khoa học: "Variable number tandem repeat analysis of Mycobacterium bovis isolates from Gyeonggi-do, Korea" ppt

... prevalence of the genotypes of the M bovis isolates was examined Two genotypes of the M bovis isolates (d.i = e, g) were prevalent in Gyeonggi-do These two genotypes of the M bovis isolates were ... Evaluation of the epidemiological relevance of variable -number tandem- repeat genotyping of Mycobacterium bovis and comparison of the method with IS6110 restri...

Ngày tải lên: 07/08/2014, 20:23

9 270 0
Báo cáo khoa học: "A comparison of dose-response characteristics of four NTCP models using outcomes of radiationinduced optic neuropathy and retinopathy" potx

Báo cáo khoa học: "A comparison of dose-response characteristics of four NTCP models using outcomes of radiationinduced optic neuropathy and retinopathy" potx

... of fitting radiationinduced optic neuropathy and retinopathy dose-response data to the aforementioned four NTCP models This is the simplest case where volume dependence is not accounted for and ... sensitivity of the model, parameters to a/b value fitting were repeated for the optic neuropathy data set with conversion to NTD performed using a/b values of and Gy...

Ngày tải lên: 09/08/2014, 09:20

10 254 0
Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf

Báo cáo khoa hoc:" A quasi-score approach to the analysis of ordered categorical data via a mixed heteroskedastic threshold model" pdf

... out to be a natural alternative to the MAP approach proposed by Foulley and Gianola !8! The main advantage of the MAP approach lies in both its conceptual and computational simplicity Part of ... J.L., San Cristobal M., Gianola D., Im S., Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian model...

Ngày tải lên: 09/08/2014, 18:21

18 297 0
Báo cáo sinh học: " Statistical analysis of ordered categorical data via a structural heteroskedastic threshold model" pdf

Báo cáo sinh học: " Statistical analysis of ordered categorical data via a structural heteroskedastic threshold model" pdf

... Cristobal M, Gianola D, Im S (1992) Marginal likelihood and Bayesian approaches to the analysis of heterogeneous residual variances in mixed linear Gaussian models Comput Stat Data Anal 13, 291-305 ... Abstract to the EAAP, Lillehammer, Norway, 25-29 August Gilmour A, Anderson RD, Rae A (1987) Variance components on an underlying scale for ordered multiple threshold categorical...

Ngày tải lên: 09/08/2014, 18:22

25 365 0
A visualization tool for the rapid analysis of bacterial transcriptome data pot

A visualization tool for the rapid analysis of bacterial transcriptome data pot

... that enables visualization of transcriptome data onto a linear map of an annotated bacterial genome and at the same time highlights additional features, such as putative regulatory sequences and ... terminators The combination of information extraction and visualization facilitates rapid, easy and intuitive analysis of genomics data, and in our research group Genom...

Ngày tải lên: 09/08/2014, 20:20

6 511 0
Từ khóa:
w