Computational analysis of 3d protein structures 1
... 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 1. 00 19 .20 18 .50 20.58 20. 71 19.36 20 .18 20 .18 18 . 71 18.85 16 .93 16 . 21 19.84 18 .95 18 .55 16 .14 14 .37 14 . 61 15.09 12 .45 13 .79 15 .13 15 .18 15 .96 15 .90 ... 1GLQ1855 1GLQ1856 1GLQ1857 1GLQ1858 1GLQ1859 1GLQ1860 1GLQ18 61 1GLQ1862 1GLQ1863 1GLQ1864 1GLQ1865 1GLQ1866 1GLQ1867 1GLQ1868...
Ngày tải lên: 15/09/2015, 17:10
... expand collocations indicative of each move (6)Develop a hidden Markov model for move tagging Figure 1: Processes used to learn collocation classifiers 3.1 Collecting Training Data In the first four ... ) t1 ,t2 , ,tn In summary, at the beginning of training time, we use a few human move- tagged sentences as seed data Then, collocation-to -move and moveto -move probabilities ar...
Ngày tải lên: 31/03/2014, 01:20
23 computational analysis of randomness in structural mechanics 2009
... in Structural Mechanics aims at detailing the computational aspects of stochastic analysis within the field of structural mechanics This book is an excellent guide to the numerical analysis of ... University of Technology in Austria since 2007 He received his Ph.D in Civil Engineering from the University of Innsbruck, Austria in 1986, where he also obtained his...
Ngày tải lên: 12/01/2014, 22:04
Tài liệu Báo cáo khoa học: Mutational analysis of plasminogen activator inhibitor-1 Interactions of a-helix F and its neighbouring structural elements regulates the activity and the rate of latency transition pdf
... a biphasic loss of activity (Fig and Table 3) The phenotype of these substitutions is therefore different from that of N139A, T146A and W141A The F residues at positions 100 and 128 are highly ... incubation for 40 The specific inhibitory activity of PAI-1 at the various timepoints, i.e the fraction of the total amount of PAI-1 forming a stable complex with...
Ngày tải lên: 20/02/2014, 11:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... residues are not described well and there is no example of mutational analysis of all of these residues in the same enzyme To obtain an insight into how the many conserved residues in the active sites ... circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30] Preliminary results of a compara...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: "A Computational Analysis of Complex Noun Phrase in Messages" docx
... Semantic patterns in complex noun phrases fall into two types: part names and other noun phrases Names for pieces of equipment often contain complex noun sequences, i.e stacked nouns The relationships ... sequences A major feature of noun phrases in this set of messages is the presence of many long sequences of left modifiers of nouns, (3) {3) (a) forward kingpost...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA) The primers used were: 5¢-TATATCATTCA GGATTATTTGTATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAGATACAAATAATCCTGAATGA ... Structure of H pylori TenA N Barison et al A B Fig TenA active site (A) Cartoon view of a detail of TenA active site The side chains of residues relevant for cataly...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: "A Linguistic and Computational Analysis of the German "Third Construction"*" potx
... terms of a closely related automaton, the Bottom-up EPDA (BEPDA) ~ The BEPDA consists of a finite-state control and of a stack of stacks There are two types of moves: either an input is read and ... new stack on top of the stack of stacks, or a fixed number of stacks below and above a designated stack on the stack of stacks is removed and a new symbol is push...
Ngày tải lên: 23/03/2014, 20:20
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot
... 522 5 SRPK1 /1a inhibition by interaction with SAFB1 /2 19 20 21 22 23 24 25 26 27 28 29 30 D Tsianou et al lamin B receptor by a serine ⁄ arginine kinase and p34(cdc2) J Biol Chem 27 2, 620 8–6 21 3 ... GST– GST– SAFB1C SAFB1CΔRE SAFB2C GST Anti-GST FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a FLAG–SRPK1 FLAG–SRPK1a Eluate FLAG–SRPK1 Fig Binding of the...
Ngày tải lên: 30/03/2014, 01:20
the design and analysis of spatial data structures - hanan samet
Ngày tải lên: 17/04/2014, 09:16
Báo cáo y học: "Cross-sectional analysis of adverse outcomes in 1,029 pregnancies of Afro-Caribbean women in Trinidad with and without systemic lupus erythematosus" ppsx
... association of high IgM ACL with preterm delivery Treatment of women with SLE during pregnancy with aspirin and/ or heparin is not, however, standard clinical practice in Trinidad These findings suggest ... activity and comorbidity in Trinidad Furthermore, termination of pregnancy is currently illegal in Trinidad and therefore is likely to have been misreported...
Ngày tải lên: 09/08/2014, 10:22
Computational Mechanics of Composite Materials Part 1 ppsx
... Some Composites 18 5 4 .1 Deterministic Problems 18 5 4 .1. 1 Sensitivity Analysis Methods 18 8 4 .1. 2 Sensitivity of Homogenised Heat Conductivity 19 1 4 .1. 3 Sensitivity of Homogenised ... applications of the MCS technique in engineering of composite materials are: (a) fatigue and/or failure modeling [10 ,243], (b) modeling of random material properties [73 ,17 1 ,17 4...
Ngày tải lên: 10/08/2014, 11:22
Báo cáo y học: "Quantitative analysis of residual protein contamination of podiatry instruments reprocessed through local and central decontamination units" docx
... Quantitative analysis of residual protein contamination of podiatry instruments reprocessed through local and central decontamination units Journal of Foot and Ankle Research 2011 4:2 Submit your next manuscript ... strategy The aim of this study was to compare the efficacy of LDU and CDU reprocessing of podiatry instruments by a quantitative assess...
Ngày tải lên: 10/08/2014, 21:24