Structural studies on DdCAD 1 a ca2+ dependent cell cell adhesion protein

Structural studies on DdCAD 1  a ca2+ dependent cell cell adhesion protein

Structural studies on DdCAD 1 a ca2+ dependent cell cell adhesion protein

... TGGAATGATAAATTCATGTCATGTTTGGTTGGTTCAAATGTTAGATGTAACATT W N D K F M S C L V G S N V R C N I 16 2 54 TGGGAGCATAATGAAATTGATACTCCAACTCCAGGAAAATTCCAAGAATTGGCT W E H N E I D T P T P G K F Q E L A 216 72 CAAGGCAGTACAAACAATGATTTAACCTCAATAAATGGTCTTTCAAAGTTCCAA ... ATGTCTGTTGATGCAAATAAAGTAAAATTCTTCTTTGGTAAAAACTGCACTGGT M S V D A N K V K F F F G K N C T G 54 18 GAATCATTTGAATACAACAAAGGTGAAACTGTAAGA...

Ngày tải lên: 15/09/2015, 17:10

216 101 0
Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

Báo cáo Y học: Structural studies on the core and the O-polysaccharide repeating unit of Pseudomonas aeruginosa immunotype 1 lipopolysaccharide pot

... In immunotype 1, the outer core has at least one O-acetylation site and the O-acetyl group is present in the core of a minority of the LPS molecules The position of the O-acetyl groups in the core ... all of the data together, the structures of the core and core with one O-polysaccharide repeating unit in the LPS of P aeruginosa immu...

Ngày tải lên: 24/03/2014, 03:21

10 473 0
Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf

Báo cáo khoa học: Mitochondrial biogenesis in mtDNA-depleted cells involves a Ca2+-dependent pathway and a reduced mitochondrial protein import pdf

... 5Â-CTTCTTTGCAGC CAGCATGAT-3Â; b-ATPase sense 5Â-CCATCCTGGGTA TGGATGAACT-3Â, antisense 5Â-GGCTGAGACAAGAA ACGCTGTAT-3Â, TBP sense 5Â-CCTCACAGGTCAAAG GTTTACAGTAC-3Â, antisense 5Â-GCTGAGGTTGCAG GAATTGAA-3Â) ... Mitochondrial protein import driving forces are decreased in mtDNA-depleted cells (A) ATP content was measured in the various cell lines using a luciferin-luciferase assay...

Ngày tải lên: 23/03/2014, 15:21

25 485 0
NMR structural studies on the pilin monomer pils from salmonella typhi

NMR structural studies on the pilin monomer pils from salmonella typhi

... (Thompson, 1994) R64: Prepilin from Plasmid R64 Type IVb pilus PilS: Prepilin from Salmonella typhi Type IVb pilus GC: Prepilin from Nesseria gonorrhoeae MS11 Type IVa pilus PAK: Prepilin from ... Comparison of the pilin structures of these two subclasses (Type IVa and IVb) suggested that Type IV pilins share a conserved architectural scaffold - 16 - PilS from Salmonella...

Ngày tải lên: 26/11/2015, 23:07

101 330 0
Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

Báo cáo Y học: Structural and functional characterization of a C-type lectin-like antifreeze protein from rainbow smelt (Osmerus mordax) potx

... digestion fragments of untreated and deglycosylated AFP 1222 J C Achenbach and K V Ewart (Eur J Biochem 269) Ó FEBS 2002 Fig Analysis of antifreeze activity Antifreeze activity was evaluated qualitatively ... chemicals were reagent grade Purification of smelt AFP Blood plasma was obtained from a population of rainbow smelt (O mordax) caught in seawater along the nor...

Ngày tải lên: 24/03/2014, 03:21

8 519 0
Báo cáo khoa học: A novel four transmembrane spanning protein, CLP24 A hypoxically regulated cell junction protein pdf

Báo cáo khoa học: A novel four transmembrane spanning protein, CLP24 A hypoxically regulated cell junction protein pdf

... gaggctgccctgcgctccgctttgctttgggattaatttattctgcatct gctgagaggggcaccccagccatatcttacactttggtaaagcagaaaac caggaaaattttcttaaaatatccacaatattccttgagtgagtcagaat ctatagccggttagtgatggtttcaggcagaatcgtgttcgtgtctgttt tgctcgattcctttcctaagttaaataaatgcaagcctctgaacttctgt ... aaaaaacaaccatttcctctctgctgagagccagggaaggcgagctctgc gcacacgggcgtccctgcagcagccactctgctttccaggaccggccaac tgccctggaggcatccacacaggggcccaggcag...

Ngày tải lên: 30/03/2014, 14:20

9 349 0
Báo cáo y học: "The integrins are a superfamily of cell adhesion receptors that bind to extracellular matrix ligands, cell-surface ligands, and soluble ligands. They are transmembrane α" ppsx

Báo cáo y học: "The integrins are a superfamily of cell adhesion receptors that bind to extracellular matrix ligands, cell-surface ligands, and soluble ligands. They are transmembrane α" ppsx

... kinase/cSrc, and the small GTPases Ras and Rho) and adaptors (for example, Cas/Crk and paxillin) that assemble within dynamic adhesion structures, including focal adhesions that bind cells to ... Integrins can be activated intracellularly by signals from G-protein-coupled receptors that lead to phosphorylation of the cytoplasmic domain of the β subunit The associ...

Ngày tải lên: 14/08/2014, 07:21

9 356 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

10 560 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

7 480 0
The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

The role of caspase 1 in a murine model of influenza pneumonitis, and studies on cell death inhibitors in vitro

... function upstream of the effector caspases in apoptosis and are known as initiator caspases A phylogenetically distinct group of 13 caspases (caspase- 1, caspase- 4, caspase- 5, caspase- 11 and caspase- 12 ) ... caspase- 1 to an influenza A/ Puerto Rico/8/34 (H1N1) virus infection of RAW264.7 murine macrophages, in vitro To investigate the role of ca...

Ngày tải lên: 13/10/2015, 16:41

190 828 0
Some studies on a probabilistic framework for finding object-oriented information in unstructured data

Some studies on a probabilistic framework for finding object-oriented information in unstructured data

... framework for finding object-oriented information in unstructured data Two above solutions can be plausible for solving object search problem Yet, the Information Extraction based solution has ... they also have some shortcomings Information Extraction based solution has low scalability and low adaptability while Text Information Retrieval based solution has high sca...

Ngày tải lên: 23/11/2012, 15:04

51 396 0
Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

Tài liệu Báo cáo khoa học: Studies on structural and functional divergence among seven WhiB proteins of Mycobacterium tuberculosis H37Rv pdf

... properties of WhiB2 , WhiB5 , WhiB6 and WhiB7 of M tuberculosis and also compare the properties of all seven WhiB proteins We show that, similar to WhiB3 and WhiB4 , other freshly purified WhiB proteins ... preparations) A + – + – + + + + – + + + + + + + + + 10X 10X 10X 10X 10X 0.1X WhiB IscS 35S-Cys Samples Atoms of iron per monomer WhiB1 WhiB1 WhiB1 WhiB...

Ngày tải lên: 18/02/2014, 12:20

18 550 0
Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

Tài liệu Báo cáo khoa học: Influence of modulated structural dynamics on the kinetics of a-chymotrypsin catalysis Insights through chemical glycosylation, molecular dynamics and domain motion analysis pptx

... questions of whether and how the enzymes structural dynamics inuence the kinetics of a-CT catalysis This was done by determining the changes in the global structural dynamics (DGHX) [38] for the ... the deprotonation and protonation rates of Ser195 thus reducing the kinetics of catalysis The results also suggest that the dynamics of the calc...

Ngày tải lên: 19/02/2014, 05:20

17 533 0
Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

Báo cáo khoa học: Identification of the structural determinant responsible for the phosphorylation of G-protein activated potassium channel 1 by cAMP-dependent protein kinase pdf

... identify the structural determinants that are responsible for phosphorylation of GIRK1 by PKA, fusion proteins comprising truncated forms of the cytosolic parts of GIRK1 and the glutathione S-transferase ... GIRK1F137S) currents had been described previously [18 ] To assess the role of the S ⁄ Ts in the regulation of GIRK1 via PKA in a manner that is unbiased...

Ngày tải lên: 07/03/2014, 00:20

9 404 0
Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

Báo cáo khoa học: Pulchellin, a highly toxic type 2 ribosome-inactivating protein from Abrus pulchellus Cloning, heterologous expression of A-chain and structural studies ppt

... Tyr158, Glu2 12, Arg215 and Trp246 in ricin) and another ve conserved residues (Asn 72, Arg 124 , Gln160, Glu195 and Asn196 in abrin -a and abrin-c and Asn78, Arg134, Gln1 72, Glu208 and Asn209 in ricin) ... Journal 27 2 (20 05) 120 1 121 0 ê 20 05 FEBS 120 3 Pulchellin A- chain: cloning and structural studies A A L C Silva et al B C Fig (A) A- chain expression anal...

Ngày tải lên: 07/03/2014, 16:20

10 396 0
Từ khóa:
w