Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

Molecular characterization and developmental analysis of interferon regulatory factor 6 (IRF6) gene in zebrafish

... mouse, Fugu, and zebrafish 63 -64 3.5 Assembled sequences of irf6 genomic fragments 64 -66 3 .6 The irf6 gene locus on the LG22 in T51 RH panel and in the Ensembl zebrafish version (ZV6) 68 -69 3.7 Whole-mount ... morpholinos 85 3.14 Loss of irf6 function phenotypes 86- 87 3.15 Comparison of expression of molecular markers in irf6 morphants and wildtype 91-92 3...

Ngày tải lên: 14/09/2015, 12:44

149 298 0
Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish

Molecular characterization and developmental analysis of the TGF beta 3 gene in zebrafish

... mutants, trunk notochords are present.  This shows that spt mutation can suppress the 35   Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish flh  mutation,  suggesting  that  in the midline,  flh  is  involved  in promoting  ... Molecular characterization and developmental analysis of the TGF Beta 3 gene in zebrafish phosphorylating  TβR­...

Ngày tải lên: 14/09/2015, 18:03

173 305 0
Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

Báo cáo khoa học: " Molecular characterization and phylogenetic analysis of the complete genome of a porcine sapovirus from Chinese swine" pdf

... GTCCACATCAACGGCCGCCGGCTCG AGCCAACAGACACTCCTGTGTTCC CATGCCAGACCCTGATATTATCACC ACCTACACCAATGTCACCTGGAC GTGCCACACCTACTATGACCACAG TCAAGCCTCCAAACCAAGCC TGGCGGTCCATAAATGAGGTG TATGCAGCTTTGGCAATTCCC TTGATCTTTAGCAACTGTATCTG ... TGGTGGAGGCCTGTTCAGAGC CCAAGTTGTGGGCTGTCAACAC CAGAGTCCTCCTGGTGGACATTC ATTACCAAGCGCAACGCTAGGC CATGTGGCCAACATGTGTG TGATTTGGTCAAGGTAGCC CCTTCTACAACACCAAATGATTGCC AGGCCAGGATGTCAACAC...

Ngày tải lên: 12/08/2014, 04:21

10 402 0
Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

Báo cáo khoa học: Isolation, characterization and expression analysis of a hypoxia-responsive glucose transporter gene from the grass carp, Ctenopharyngodon idellus potx

... 5¢-CCTGATCGACGCACGAGT-3¢ and GT1-R, 5¢-TTTTGCAAGTCATAGTAATCAGTTT-3¢ for GTcDNA1 (2150 bp); and GT2-F, 5¢-CACCAGCAACTAC CTGATCGA-3¢ and GT2-R, 5¢-CACAAAATATGCTT CCAAGTGC-3¢ for GT-cDNA2 (3043 bp) RNA isolation and ... revealed two putative polyadenylation (ATTAAA) signals: one is located 18 bp upstream from the poly (A) of GT-cDNA1 and another is located 11 bp upstream from...

Ngày tải lên: 17/03/2014, 03:20

8 466 0
Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

Báo cáo khoa học: Genomic structure and expression analysis of the RNase j family ortholog gene in the insect Ceratitis capitata pptx

... organization of the ORF region of the RNase j family genes is shown in Fig 7A In all organisms examined, the region coding for RNase j is interrupted by two introns, with the exception of the sea urchin ... describe the expression profile of the RNase j gene at various developmental stages and in several tissues of the insect C capitata W...

Ngày tải lên: 23/03/2014, 06:20

11 480 0
Molecular characterization and developmental expression patterns of the zebrafish twist gene family

Molecular characterization and developmental expression patterns of the zebrafish twist gene family

... pattern with other species 83 4.5.1 Zebrafish twist1 a and twist1 b genes 83 4.5.2 Zebrafish twist2 85 4.5.3 Zebrafish twist3 86 4.6 Shared and unique expression sites of the zebrafish twist genes 86 ... proteins generated by the neighbor-joining method Figure 3.6: Gene structure of twist1 a, twist1 b, twist2 and twist3 Figure 3.7: RT-PCR of zebrafish...

Ngày tải lên: 16/10/2015, 15:38

115 268 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... to their positions The arrowheads depict the residues important for the structural core of the IL-10 gene The underlined amino acid residues are the signal sequences of the respective genes The ... conclusion, the IL-10 gene from carp has been isolated and its genomic structure and expression analysis investigated This work will pave the way for further inves...

Ngày tải lên: 20/02/2014, 02:21

8 588 0
Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... The histamine releases were measured by an enzyme immunoassay (Immunotech) After subtraction of the spontaneous release of the basophils, the allergeninduced histamine release was calculated as ... self-prepared tomato extract, nLyc e 2, rLyc e 2, horseradish peroxidase, deglycosylated horseradish peroxidase, the glycopeptide MUXF and MUXF conjugated to BSA as well as BSA alone...

Ngày tải lên: 21/02/2014, 00:20

11 536 0
Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

Báo cáo khoa học: Characterization and expression analysis of the aspartic protease gene family of Cynara cardunculus L. docx

... pattern of expression of a gene [34–39] To evaluate the relevance of the leader intron in cardosin expression, we deleted it from the 5¢-flanking region of the genes (Fig 8) The deletion of the cardosin ... region of the cardosin B gene (from ) 147 bp to + 238 bp) .The 529 bp of the promoter region of the cardosin A gene that is relevant for gene...

Ngày tải lên: 30/03/2014, 09:20

17 361 0
Báo cáo y học: " Complete coding sequence characterization and comparative analysis of the putati" docx

Báo cáo y học: " Complete coding sequence characterization and comparative analysis of the putati" docx

... drafted the manuscript SP and KS participated in the sequence alignment PL and YP participated in the design of the study and performed the data statistical analysis YP conceived of the study in ... only 64% sequence identity with the other HRV-Cs HRV-CU072 coding sequence analysis To investigate the molecular characteristics of the putative new HRV-C...

Ngày tải lên: 11/08/2014, 21:21

12 456 0
báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf

báo cáo khoa học: " Characterization and structural analysis of wild type and a non-abscission mutant at the development funiculus (Def) locus in Pisum sativum L" pdf

... and attachment of pea seeds to the replum in a pod of the def mutant pea The def mutant pea shows a swollen and thick funicle compared to the wild type Arrows indicate the AZ and ALZ in the wild ... growing of the plants, harvested materials, carried out the structural examination and drafted the manuscript YKL participated in designing t...

Ngày tải lên: 12/08/2014, 03:20

7 373 0
Characterization and performance analysis of bifacial solar cells and modules

Characterization and performance analysis of bifacial solar cells and modules

... applications and challenges with bifacial solar cells and modules 10 Background 10 2.1.1 Bifacial solar cells and module structures 10 2.1.2 History of bifacial solar cells and modules ... solar cells and modules This thesis focuses on characterisation and standardisation of bifacial solar cells and modules, and on performance evaluatio...

Ngày tải lên: 09/09/2015, 08:13

179 945 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 1

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 1

... et al., 19 99) 10 0! Table 13 : Changes to ID2 protocol for expression and purification of ID2 and ID3 mutants 10 3! Table 14 : ID1 & ID2 constructs and their theoretical biochemical ... al., 19 90, Biggs, et al., 19 92, Christy, et al., 19 91, Riechmann, et al., 19 94, Sun, et al., 19 91) The mammalian family consisted of four members, namely ID1, ID2, ID3 and ID4...

Ngày tải lên: 09/09/2015, 10:20

30 305 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 2

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 2

... cDNA (bp) AA start AA end #AA pI MW (kDa) 4 02 177 24 6 339 21 9 28 8 Construct 24 1 24 134 82 82 113 82 82 134 59 82 113 73 96 7.8 6.1 8.8 9 .2 6.1 8.8 14.9 6.8 9.3 12. 7 8.3 10.8 Full Length HLH24- 82 ... structure of ID2 3) Analyze the structure of ID2 and look at similarities and differences to other HLH-containing proteins including ID3 ! 20 ! 4) Determine differenc...

Ngày tải lên: 09/09/2015, 10:20

19 292 0
Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 3

Structural characterization and biochemical analysis of ID2, an inhibitor of DNA binding 3

... marker (lane M, kDa) N-HLH82-L (gel A, lane 1), HLH24-82-L (gel B, lane 2), HLH24-82-L-Se-Met (gel C, lane 3) ! 38 ! 3. 3 Protein Identification The purified samples were excised from the gel and analyzed ... SILSLQASEF PSELMSNDSK ALCG Match to: Q53H99_HUMAN Score: 17248 Inhibitor of DNA binding variant (Fragment).- Homo sapiens (Human) Found in search of C:\Documents and Set...

Ngày tải lên: 09/09/2015, 10:20

5 254 0
w