Functional studies on nerve growth factor and its precursor from naja sputatrix

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

Báo cáo y học: "Functional significance of nerve growth factor and its receptor (TrkA) in inflammatory arthritis" pps

... to in uence the in ammatory and proliferative cascades of PsA and RA Abbreviations ELISA, enzyme-linked immunosorbent assay; FLS, fibroblast-like synoviocyte; NGF, nerve growth factor; NGF-R, nerve ... expression in rheumatoid arthritis and spondyloarthritis Arthritis Res Ther 2009, 11:R82 Raychaudhuri SP, Raychaudhuri SK: The regulatory role of nerve growth factor...

Ngày tải lên: 12/08/2014, 14:21

2 264 0
Báo cáo khoa hoc:" VEGF receptors on PC12 cells mediate transient activation of ERK1/2 and Akt: comparison of nerve growth factor and vascular endothelial growth factor" doc

Báo cáo khoa hoc:" VEGF receptors on PC12 cells mediate transient activation of ERK1/2 and Akt: comparison of nerve growth factor and vascular endothelial growth factor" doc

... demonstrated that VEGF1 65 induced transient activation of ERK1/2 and Akt after In contrast, NGF produced a stronger and persistent phosphorylation of ERK1/2 and Akt than VEGF1 65 much more pronounced ... Sustained activation of the mitogen-activated protein (MAP) kinase cascade may be required for differentiation of PC12 cells Comparison of the effects of...

Ngày tải lên: 11/08/2014, 08:20

6 275 0
Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx

Báo cáo y học: "Nerve growth factor and receptor expression in rheumatoid arthritis and spondyloarthritsi" potx

... NGF expression by staining on a single cell level using flow cytometry Concomitant staining of cell surface markers and intracellular NGF revealed the presence of NGF in T lymphocytes (CD3+) and ... Figure NGF staining by flow cytometry PBMC of (a) healthy controls (HC) and (b) synovial fluid mononuclear cells (SFMC) from spondyloarthritis (SpA), cytometry and (c) rheumatoid ar...

Ngày tải lên: 09/08/2014, 14:21

9 350 0
Báo cáo y học: " Increased expression of matrix metalloproteinase-10, nerve growth factor and substance P in the painful degenerate intervertebral disc" pot

Báo cáo y học: " Increased expression of matrix metalloproteinase-10, nerve growth factor and substance P in the painful degenerate intervertebral disc" pot

... of PC-12 cells strongly induces MMP-10 gene expression We have previously identified the expression of the neurotrophin NGF and the pain-associated neuropeptide substance P in the human IVD and ... to increased nociception in painful IVD degeneration Page of (page number not for citation purposes) The aim of the current study was to examine the gene...

Ngày tải lên: 09/08/2014, 14:22

8 674 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

10 560 0
Báo cáo khoa học: " Angiogenesis effects of nerve growth factor (NGF) on rat corneas" docx

Báo cáo khoa học: " Angiogenesis effects of nerve growth factor (NGF) on rat corneas" docx

... postoperative day to day Vessels were first noted on postoperative day As progressed, the Angiogenesis effects of nerve growth factor (NGF) on rat corneas 129 Fig Appearance of angiogenesis on day ... 1.0 ng of NGF group (Group 1.0), and the 5.0 ng of NGF group (Group 5.0) Data analysis The significant differences between groups were Angiogenesis effects o...

Ngày tải lên: 07/08/2014, 15:20

6 361 0
Báo cáo khoa học: "Immunohistochemical Localization of Nerve Growth Factor,Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil" ppsx

Báo cáo khoa học: "Immunohistochemical Localization of Nerve Growth Factor,Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil" ppsx

... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in Mesencephalon, Rhombencephalon, and Spinal Cord of Developing Mongolian Gerbil ... Immunohistochemical Localization of Nerve Growth Factor, Glial Fibrillary Acidic Protein and Ciliary Neurotrophic Factor in...

Ngày tải lên: 07/08/2014, 15:20

7 314 0
Báo cáo khoa học: "In vitro and in vivo gene therapy with CMV vector-mediated presumed dog b-nerve growth factor in pyridoxine-induced neuropathy dogs" pot

Báo cáo khoa học: "In vitro and in vivo gene therapy with CMV vector-mediated presumed dog b-nerve growth factor in pyridoxine-induced neuropathy dogs" pot

... Mata M, Fink DJ In vivo gene therapy for pyridoxine-induced neuropathy by herpes simplex virus-mediated Presumed dog β-NGF gene therapy in vitro and in vivo 373 gene transfer of neurotrophin-3 Ann ... determine the effect of the cytomegalovirus (CMV) vector-mediated gene transfer of the pdβ-NGF in vitro and gene therapy using recombinant pdβ-NGF p...

Ngày tải lên: 07/08/2014, 23:22

7 276 0
Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

Báo cáo y học: "Nifedipine decreases sVCAM-1 concentrations and oxidative stress in systemic sclerosis but does not affect the concentrations of vascular endothelial growth factor or its soluble receptor" potx

... including hypoxic conditions and stimulation by transforming growth factor, CD40 ligand, interleukin 1, or interleukin [10] Oxidative stress also promotes angiogenesis [13] The link between oxidative ... diffusible proteins from mature, monomeric VEGF), but not human placenta-derived growth factor, platelet-derived growth factor, or transforming growth factor In...

Ngày tải lên: 09/08/2014, 01:23

6 518 0
Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

Functional studies on sulphation status of heparan sulphate in breast non tumourigenic epithelial and cancer cells

... FUNCTIONAL STUDIES ON SULPHATION STATUS OF HEPARAN SULPHATE IN BREAST NON- TUMOURIGENIC EPITHELIAL AND CANCER CELLS GUO CHUNHUA (B.Med., M.Med.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF ... Undersulphation of GAGs inhibited invasion of breast cancer cell in vitro 120 Discussion 123 HSPG and breast cancer growth 123 HSPG and adhesion,...

Ngày tải lên: 12/09/2015, 08:18

289 368 0
Structural and functional studies on type III and type VI secretion system proteins

Structural and functional studies on type III and type VI secretion system proteins

... I Secretion System 1.6 Type II Secretion System 10 1.7 Type III Secretion System 12 1.8 Type IV Secretion System 26 1.9 Type V Secretion System 27 1.10 Type VI Secretion System 29 1.11 Aim of ... Island Figure: Type I–V secretion systems in Gram-negative bacteria Figure: 1.3 Model of pilus-mediated secretion via the type II secretion system 11...

Ngày tải lên: 14/09/2015, 14:13

169 357 0
Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

Tài liệu Báo cáo khoa học: Synergistic activation of signalling to extracellular signal-regulated kinases 1 and 2 by epidermal growth factor and 4b-phorbol 12-myristate 13-acetate pptx

... regulation of the epidermal growth factor receptor by protein kinase C J Biol Chem 2 71, 12 8 91 12 896 51 El-Shemerly, M.Y., Besser, D., Nagasawa, M & Nagamine, Y (19 97) 12 -O-Tetradecanoylphorbol -13 -acetate ... of receptor, Grb2 adapter protein, and Sos nucleotide exchange factor Cell 73, 611 – 620 12 Schlessinger, J (19 93) How receptor tyrosine kinases activate...

Ngày tải lên: 19/02/2014, 16:20

9 543 0
Báo cáo khóa học: Nerve growth factor mediates activation of the Smad pathway in PC12 cells doc

Báo cáo khóa học: Nerve growth factor mediates activation of the Smad pathway in PC12 cells doc

... activation of the Smad pathway independently of the TGF-b ligand Fig PC12 cells express low levels of endogenous TbRII (A) C-terminal phosphorylation of Smad2 was investigated in either parental PC12 cells ... Smad activation occurs independently from phosphorylation at the C-terminal SSXS-motif Involvement of Smad4 in NGF-triggered activation of t...

Ngày tải lên: 16/03/2014, 16:20

12 539 0
Báo cáo khoa học: Tetranectin binds hepatocyte growth factor and tissue-type plasminogen activator potx

Báo cáo khoa học: Tetranectin binds hepatocyte growth factor and tissue-type plasminogen activator potx

... of hepatocyte growth factor activator by thrombin J Biol Chem 268, 2292722932 Mars, W.M., Zarnegar, R & Michalopoulos, G.K (1993) Activation of hepatocyte growth factor by the plasminogen activators ... activators uPA and tPA Am J Pathol 143, 949958 Thewke, D.P & Seeds, N.W (1996) Expression of hepatocyte growth factor/ scatter factor, its receptor, c-met, and tissu...

Ngày tải lên: 17/03/2014, 03:20

5 411 1
w