Development of a fluorescence correlation spectroscopy method for the study of biomolecular interactions
... products labeled with the same fluorescent dye, the only way of differentiating the product from the reactant is when the product has a molecular mass that differs from the reactants by at least a factor ... of the dual-color complexes formed This easily distinguishes the products from the free reactants via the amplitude of the CCF, as compared to the weak depe...
Ngày tải lên: 14/09/2015, 10:36
... to study partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of...
Ngày tải lên: 23/06/2014, 00:20
... Characterization of Diffusion Behavior of a Novel Extra- cellular Sphingolipid Associated Peptide Probe by Fluorescence Correlation Spectroscopy and Imaging Total Internal Reflection Fluorescence ... cell membrane organization traced by SBD, two new biophysical tool Imaging Total Internal Reflection -Fluorescence Correlation Spectrosc...
Ngày tải lên: 12/09/2015, 09:55
A correlation based method for direction finding of multipath signals in frequency hopping systems
... communication systems In smart antenna systems, the direction of users is an important factor to increase the capacity, and an antenna array is usually used at the base station to estimate and track ... hopping signals, and a new method is proposed to track multipath frequency hopping signals In Chapter 2, several popular methods for DOA estimation are addressed in...
Ngày tải lên: 15/09/2015, 22:51
Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot
... like to have an efficient algorithm for finding the best possible encoding of any given meet semilattice The encoding can be represented as a collection of sets of integers (representing bit indices ... optimal encoding is the collection of sets whose overall union is smallest subject to the constraint that the collection forms an encoding at all This combinatorial optimizatio...
Ngày tải lên: 17/03/2014, 00:20
a novel method for the synthesis of titania nanotubes using
... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...
Ngày tải lên: 05/05/2014, 15:26
a novel method for the synthesis of cao nanoparticle
... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15 agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...
Ngày tải lên: 06/05/2014, 08:55
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... 5'-CCGTAGGCGATGGTCGTCCTAACRAAYTGNGG-3' 5'-TACAAAATACAGCGAGTGATANATRAARCA-3' ORF 59 (RFHV/KSHV)7 5'-TGAAAATCCACAGGCATGAT-3' 1The terminal "a" or "b" in the primer name indicates the plus or minus sense of the gene transcription, ... at the WaNPRC DNA samples were obtained from PBMC of a random assortment of thirty macaques housed at the WaNPRC and analyzed using the...
Ngày tải lên: 18/06/2014, 22:20
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approve...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot
... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt
... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...
Ngày tải lên: 21/06/2014, 01:20
Báo cáo hóa học: " Research Article A New General Iterative Method for a Finite Family of Nonexpansive Mappings in Hilbert Spaces Urailuk Singthong1 and Suthep Suantai1, 2" potx
... and Suantai introduced a new mapping, called Kmapping, for finding a common fixed point of a finite family of nonexpansive mappings For a finite family of nonexpansive mappings {Ti }N1 and sequence ... Proceedings of the American Mathematical Society, vol 4, pp 506–510, 1953 S Reich, “Weak convergence theorems for nonexpansive mappings in Banach spac...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo hóa học: " Research Article Convergence of a Mimetic Finite Difference Method for Static Diffusion Equation" doc
... Castillo and R D Grone, A matrix analysis approach to higher-order approximations for divergence and gradients satisfying a global conservation law,” SIAM Journal on Matrix Analysis and Applications, ... ı Libertador, Avenida P´ ez, El Paraiso Coding Postal 1020, Caracas, Venezuela a Email address: mayrafreites@cantv.net J E Castillo: Computational Science Research Center, San Diego...
Ngày tải lên: 22/06/2014, 19:20