Functional study of MicroRNA 125b in vertebrate development 1
... Biogenesis of microRNAs 1. 1.3 Targets of microRNAs 1. 2 The role of microRNAs in development 1. 2 .1 microRNA functions in embryogenesis 1. 2.2 microRNA functions in stem cell development 1. 2.3 microRNA ... functions in neurogenesis 1. 3 microRNAs in diseases 11 1. 4 The expression and known functions of miR -12 5b 14 1. 5 Motivation of the thesis...
Ngày tải lên: 14/09/2015, 08:42
... 95%, n = 85 m 125 bMO + p53MO m 125 bMO * * 98%, n = 1 12 100%, n = 114 * lp 125 bMO1 /2/ 3 in p53M214K mutant 100%, n = 113 * lp 125 bMO1 /2/ 3 + p53MO lp 125 bMO1 /2/ 3 Figure 20 - Rescue of miR - 125 b morphants ... Log2 fold change in miR - 125 b level 8 ** -2 -4 ** 125 b- AS NC-AS1 125 b- DP NC-DP2 -6 Mock b Log2 fold change in miR - 125 b level a Figure 14 - Validation...
Ngày tải lên: 14/09/2015, 08:42
... ………………………………….4 1. 3 Regulation of flower development in Arabidopsis thaliana ……………………….9 1. 4 Patterning and differentiation of lateral organs in Arabidopsis thaliana 13 1. 4 .1 The patterning of lateral ... Results…………………………………………………………………………… 11 6 5.2 .1 Protein sequence alignment for GIK1 and GIK2.…………………… 11 6 5.2.2 Expression of GIK2 in inflorescence...
Ngày tải lên: 14/09/2015, 08:46
Functional characterization of giant killer in flower development and meristem regulation in arabidopsis thaliana 2
... reported to be involved in the regulation of flowering and hypocotyl elongation (Xiao et al., 20 09) Overexpression of AHL 22 effectively delays the flowering process in Arabidopsis In spite of these ... transforms the inflorescence meristem into a terminal flower Figure 1: Inflorescence meristem and floral meristem in Arabidopsis thaliana Upper panel: sche...
Ngày tải lên: 14/09/2015, 08:46
Báo cáo sinh học: " Functional relevance of nonsynonymous mutations in the HIV-1 tat gene within an epidemiologically-linked transmission cohort" pot
... and R52 participates in the binding of Tat to TAR and is involved in the nuclear localisation of Tat [18,19] The strong or total suppression of transactivation abilities observed in many of the ... selection of multiple nonsynonymous mutations in tat in a unique epidemiologically-linked cohort following transmission of HIV-1 Comparisons of the...
Ngày tải lên: 18/06/2014, 18:20
Association study of ABCA1 polymorphisms in singapore populations 1
... normolipidemic Inuits The two major objectives of the dissertation were: Identification of ABCA1 polymorphisms that might be useful in a genetic association study; and Association analysis of ABCA1 SNPs ... contribution of ABCA1 SNPs to inter-individual differences in CAD susceptibility and intermediate phenotype variation, with only Wang et al (2000) reporting an as...
Ngày tải lên: 16/09/2015, 17:14
A study of poetic landscapes in danyings poems 1
... iii! ! iv! Abstract This thesis makes the claim that poetic landscapes in Danying’s poems reflect her cultural nostalgia and her quests for subjectivity The poetic landscapes indicate Danying’s perceptions ... perceptions of the world and can be seen as an interface where she interprets her cultural nostalgia and her lurking fears of being rootless as an overseas Chinese The c...
Ngày tải lên: 01/10/2015, 17:28
Báo cáo khoa học: Functional expression of olfactory receptors in yeast and development of a bioassay for odorant screening docx
... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Functional assignment of motifs conserved in b1,3-glycosyltransferases A mutagenesis study of murine UDP-galactose:b-N-acetylglucosamine b1,3-galactosyltransferase-I pptx
... AAATGAGCCCAACAAAGCCGAGAAAAACATT AATTTGATGCTCGACAGGCTGCCGCGGAGACATGG CAATCCGGGAGACAGCTGGTGATGAAAA TAGCCACACTTGCAGCCGCGGCCAAAAATG TTAATGGGGATGAGAGCGGTTGCCACTTTCT AGATGGGTTGGCAACTTTCGCTTCAAAA TGAAAACCGCCAGTGCTATTGCTGTGAACA ... TGAAAACCGCCAGTGCTATTGCTGTGAACA CCTGACAGCAACTACGCAGCGTTCTGTTCAG AGCAACTATCCACCGTTCGCTTCAGGGACTG TGCTTCATCTTGCTGACGTGTACGTGGGACT ATGTGTACGTGGGACTGGCACTTCGAAAGC AAAATGGCCTACA...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khoa học: "Study on mechanism of multistep hepatotumorigenesis in rat: development of hepatotumorigenesis" pdf
... greater and their sizes increased (Fig 2) No such defects were observed in the control group Study on mechanism of multistep hepatotumorigenesis in rat: Development of hepatotumorigenesis 55 ... acute and chronic hepatitis [5, 7, 8, 21] Its activity increased continuously during our study The effect of carcinogenesis on the free radicals concentration needs further...
Ngày tải lên: 07/08/2014, 14:23
Biochemical identification and functional characterization of microrna target interactions in growth control and cancer transformation
... characterizations of miRNA -target interactions involved in growth control and cancer transformation I used biochemical immunoprecipitation against Drosophila Ago1 (Ago1-IP) to isolate and purify Ago1/miRNA/mRNA ... protein (green) and GW182 (blue) GW182 proteins contain an N-terminal AGO-binding domain, which provides multiple binding sites for Argonaute proteins and...
Ngày tải lên: 09/09/2015, 10:17
Development of a robotic nanny for children and a case study of emotion recognition in human robotic interaction
... role in human emotion perception and social interaction, and has attracted much attention in the areas of pattern recognition, computer vision, human- computer interaction, and humanrobot interaction ... and teachers, and can be employed for animal-assisted therapy (AAT) and animal-assisted activities (AAA) instead of real animals [2] This can partly reduce wor...
Ngày tải lên: 09/09/2015, 10:18
Genetic study of hematopoiesis in zebrafish characterization of zebrafish udu mutant, positional cloning and functional study of udu gene
... GENETIC STUDY OF HEMATOPOIESIS IN ZEBRAFISH — CHARACTERIZATION OF ZEBRAFISH UDU MUTANT, POSITIONAL CLONING AND FUNCTIONAL STUDY OF UDU GENE LIU YANMEI (Master of Medicine, Peking University, ... differentiation of hematopoietic cells in udu- /- 94 4.1.2 Identification of the udu mutant gene 100 4.1.2.1 Positional cloning of udu gene...
Ngày tải lên: 14/09/2015, 17:54