A solid shell element based on relative displacements concept theory and applications

A solid shell element based on relative displacements concept  theory and applications

A solid shell element based on relative displacements concept theory and applications

... A SOLID SHELL ELEMENT BASED ON RELATIVE DISPLACEMENTS CONCEPT: THEORY AND APPLICATIONS MA YONGQIAN B.Eng (Nanjing University of Aeronautics and Astronautics, P.R.China), M.Eng.(Zhejiang University, ... M.Eng.(Zhejiang University, P.R.China) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF CIVIL ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE 2006...

Ngày tải lên: 12/09/2015, 21:29

159 170 0
Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

Báo cáo khoa học: "A New Statistical Parser Based on Bigram Lexical Dependencies" potx

... 100 words in section 23 using model (3) For 'no lexical information' all estimates are based on POS tags alone For 'no distance measure' the distance measure is Question alone (i.e whether zbj ... backed-off estimation strategy is used for making prepositional phrase attachment decisions The idea is to back-off to estimates based on less context In this case, less context means look...

Ngày tải lên: 08/03/2014, 07:20

8 324 0
Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

Báo cáo khoa học: Sequences and structural organization of phospholipase A2 genes from Vipera aspis aspis, V. aspis zinnikeri and Vipera berus berus venom Identification of the origin of a new viper population based on ammodytin I1 heterogeneity docx

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

10 454 0
Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

Báo cáo khoa học: Fast set-up of doxycycline-inducible protein expression in human cell lines with a single plasmid based on Epstein– Barr virus replication and the simple tetracycline repressor ppt

... of individual clones In contrast, plasmids with an Epstein Barr virus (EBV) origin of replication oriP in the presence of EBV-encoded EBNA-1 protein are continuously propagated in 1% of initially ... acid assay [25] with bovine serum albumin as standard The protein content of MS samples was estimated from the response ratio for proline, which was calibrated...

Ngày tải lên: 23/03/2014, 09:21

8 331 0
Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx

Báo cáo khoa học: "A Novel Discourse Parser Based on Support Vector Machine Classification" docx

... compositionality criterion (see Sect 3.5), we expect to see certain correlations between the relation being classified and relation patterns in either sub-tree, based on theoretical considerations ... note that in order to achieve good results on relation labeling, Strong Compositionality Criterion We make use of Marcu’s ‘Strong Compositionality Criterion’ (Marcu, 1996) through a very si...

Ngày tải lên: 30/03/2014, 23:20

9 390 0
Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

Báo cáo sinh học: " Development of a model for marburgvirus based on severe-combined immunodeficiency mice" doc

... Molecular characterization of guinea pig-adapted variants of Ebola virus Virology 2000, 277(1):147-155 Ebihara H, Takada A, Kobasa D, Jones S, Neumann G, Theriault S, Bray M, Feldmann H, Kawaoka Y: ... limitations in the numbers of guinea pigs that can be evaluated at one time (based on BSL-4 space limitations, as well as physical demands on investigators and technicians) and the...

Ngày tải lên: 18/06/2014, 18:20

13 458 0
Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf

Báo cáo hóa học: " A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients" pdf

... A biofeedback cycling training to improve locomotion: a case series study based on gait pattern classification of 153 chronic stroke patients Simona Ferrante1*, Emilia Ambrosini1, Paola Ravelli1, ... effects on cycling and walking ability in chronic stroke patients A case series study was designed and participants were recruited based...

Ngày tải lên: 19/06/2014, 08:20

13 444 0
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx

Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx

... layout map matrix adequate for our simulation environment The walls are depicted in black, not easily reachable forest area is marked with dark gray, and flowerbed areas are drawn in light gray ... Kaiser, P Robertson, M Angermann, A three dimensional movement model for pedestrian navigation, in European Navigation Conference–Global Navigation Satellite Systems 2009 (ENC-GNSS 200...

Ngày tải lên: 21/06/2014, 01:20

14 488 0
Báo cáo hóa học: " Core shell hybrids based on noble metal nanoparticles and conjugated polymers: synthesis and characterization" ppt

Báo cáo hóa học: " Core shell hybrids based on noble metal nanoparticles and conjugated polymers: synthesis and characterization" ppt

... appropriate conjugated polymeric shell Conclusions A versatile and facile synthesis of core shell systems based on noble metal nanoparticles (AuNPs, AgNPs, PtNPs), coated by polymers and copolymers belonging ... applications such as biolabelling and drug delivery In this paper, the synthesis and characterization of core shell systems based on noble met...

Ngày tải lên: 21/06/2014, 06:20

8 383 0
Báo cáo hóa học: " Research Article A Skin Detection Approach Based on Color Distance Map" doc

Báo cáo hóa học: " Research Article A Skin Detection Approach Based on Color Distance Map" doc

... USA, January 2006 M.-H Yang and N Ahuja, “Gaussian mixture model for human skin color and its applications in image and video databases,” in Storage and Retrieval for Image and Video Databases ... Rama, “GTAV Face Database,” http://gpse tsc.upc.es/GTAV/ResearchAreas/UPCFaceDatabase/GTAVFaceDatabase.htm [24] A K Bera and C M Jarque, “Efficient tests for normality, homoscedasticity and seri...

Ngày tải lên: 21/06/2014, 22:20

10 230 0
Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc

Báo cáo hóa học: "Research Article A Color Topographic Map Based on the Dichromatic Reflectance Model" doc

... “Baboon.” A COLOR TOPOGRAPHIC MAP IN ACCORDANCE WITH THE DICHROMATIC MODEL One of our motivations is to extract color sets and lines in accordance with the image content without any color conversion ... A B Figure 13: Evaluation of the robustness of topographic maps to illuminant changes The curves indicate the percentage of points of the topographic map whic...

Ngày tải lên: 21/06/2014, 22:20

14 343 0
Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

Báo cáo hóa học: " Research Article A Suboptimal PTS Algorithm Based on Particle Swarm Optimization Technique for PAPR Reduction in OFDM Systems" potx

... monopole antenna using a particle swarm optimization approach,” IEEE Transactions on Antennas and Propagation, vol 53, no 10, pp 1–7, 2005 [24] J Robinson and Y Rahmat-Samii, Particle swarm optimization ... Ho, A S Madhukumar, and F Chin, “Peak-to-average power reduction using partial transmit sequences: a suboptimal approach based on dual layered phase sequencing,”...

Ngày tải lên: 21/06/2014, 23:20

8 407 0
Báo cáo hóa học: " Synthesis of High Coercivity Core–Shell Nanorods Based on Nickel and Cobalt and Their Magnetic Properties" pot

Báo cáo hóa học: " Synthesis of High Coercivity Core–Shell Nanorods Based on Nickel and Cobalt and Their Magnetic Properties" pot

... can render very high coercivity with the higher contribution of shape anisotropy and higher coercivity hybrid nanorods can find applications in fields such Fig M(H) curves of Ni @ Co nanorods; a at ... fabrication of such a one-dimensional system namely Ni @ Co nanorods, which is essentially a core–shell architecture (Ni as core and Co as shell) and studies on their...

Ngày tải lên: 22/06/2014, 00:20

5 409 0
Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" doc

Báo cáo hóa học: " Research Article A Fixed Point Theorem Based on Miranda Uwe Sch¨ fer a" doc

... Stiintifice ale Universitatii Al I Cuza din Iasi Serie Noua Matematica, vol 37, no 2, pp 161–164, 1991 [7] C Avramescu, A generalization of Miranda s theorem, ” Seminar on Fixed Point Theory ClujNapoca, ... Bollettino dell’Unione Matematica Italiana, vol 3, pp 5–7, 1940 [2] M N Vrahatis, A short proof and a generalization of Miranda s existence theorem, ” Proceedings of the Ameri...

Ngày tải lên: 22/06/2014, 06:20

5 225 0
w