Baculovirus mediated genetic modification of human embryonic stem cells

Baculovirus mediated genetic modification of human embryonic stem cells

Baculovirus mediated genetic modification of human embryonic stem cells

... 1.1.1 Human Embryonic Stem Cells 1.1.2 Non-Viral Genetic Modification Systems for hES Cells 1.1.3 Viral Vectors for Genetic Modification of hES Cells 1.1.4 Baculovirus Vectors Mediated ... BACULOVIRUS- MEDIATED GENETIC MODIFICATION OF HUMAN EMBRYONIC STEM CELLS DU JUAN (B Sc.) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT...

Ngày tải lên: 11/09/2015, 14:38

135 219 0
Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

Báo cáo y học: "Low temperature tolerance of human embryonic stem cells"

... JM Embryonic stem cell lines derived from human blastocysts Science 1998;282(5391):1145-7 Reubinoff BE, Pera MF, Fong CY, Trounson A, Bongso A Embryonic stem cell lines from human blastocysts: ... Germany) with an HBO-103 mercury lamp and filter sets for FITC, Cy3.5, Texas Red, Cy5, Aqua, and DAPI Images were captured, processed, and analyzed using ISIS mBAND/mFISH imaging softwar...

Ngày tải lên: 31/10/2012, 16:57

6 479 0
báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

báo cáo hóa học:" MicroRNA and gene expression patterns in the differentiation of human embryonic stem cells" doc

... family, the miR-200 family have been reported in human [16,17] and mouse embryonic stem cells [18-20] The unique patterns of miRNA expression in embryonic stem cells suggest they are involved in maintaining ... instance, miR-373 induces the expression of E-cadherin and CSDC2 by targeting their promoter region and initiate their expression[ 73] Another me...

Ngày tải lên: 18/06/2014, 15:20

17 593 0
báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

báo cáo khoa học: "Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease" potx

... Rada-Iglesias A, Wysocka J: Epigenomics of human embryonic stem cells and induced pluripotent stem cells: insights into pluripotency and implications for disease Genome Medicine 2011, 3:36 ... Feinberg AP: Differential methylation of tissue- and cancer-specific CpG island shores distinguishes human induced pluripotent stem cells, embryonic stem...

Ngày tải lên: 11/08/2014, 12:21

13 340 0
The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders

The derivation, propagation, storage and gene expression of human embryonic stem cells on human feeders

... in the body There are four classes of pluripotent stem cells in humans, other primates and mice These are embryonic stem cells, embryonic germ cells, embryonic carcinoma cells and recently the ... stem cells versus embryonic stem cells The general differences between the characteristics of adult and embryonic stem cells are summarised in Table...

Ngày tải lên: 16/09/2015, 15:55

207 368 0
IN VIVO  EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS

IN VIVO EX VIVO OSTEOGENESIS OF HUMAN EMBRYONIC STEM CELLS

... staining (c) hFOB H & E staining (d) hFOB von Kossa staining Scaffold (e) hFOB H & E staining Figure At 2-week time point: H&E staining and von Kossa staining of sections showing scaffold and cells ... time point: H&E staining and von Kossa staining of sections showing scaffolds devoid of cells 43 Figure At week time-point: (a) H&E staining showing newly formed tissue within the ......

Ngày tải lên: 09/10/2015, 11:24

77 974 0
Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28

Transcriptome study of human embryonic stem cells and knockdown study of a pluripotency marker, LIN28

... CATGTTCGGTTGGTCAAAGA CCCAAGAGATCCCCCACAT GTTGTTACCTCAAACCTCCTTTCC GCACCACGAACGCCTTTG GCGGTGTGCGGATGGTA CCCTAGAGATAAGGCGCTTCAG AAGATGGTGGATGCTTCCAAAA ACCACTCGGAGGACCTGTTTT ACAGCAAATGACAGCTGCAAA ... GACCTCCACAGTTGTAGCAA 3’ TRCN 0000102579 LIN28sh2F 5’ CGCGTCATCTGTAAGTGGTTCAACGTTTCAAGAGAACGTTGAACCAC TTACAGATGTTTTTCATATGAT 3’ LIN28sh2R 5’ CGATCATATGAAAAACATCTGTAAGTGGTTCAACGTTCTCTTGAAAC GTTGAACCAC...

Ngày tải lên: 16/10/2015, 11:58

109 372 0
báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

báo cáo hóa học:" Transplantation of vascular cells derived from human embryonic stem cells contributes to vascular regeneration after stroke in mice" docx

... transplanted vascular cells derived from human ES cells and the vascular density in the infarct area after the transplantation In the saline- and hMNCs-injected groups, the vascular density of host ... characterization of transplanted cells derived from human ES cells We induced differentiation of human ES cells in an in vitro two-dimensional cu...

Ngày tải lên: 18/06/2014, 15:20

14 451 0
Báo cáo y học: " GeneChip analysis of human embryonic stem cell differentiation into hemangioblasts: an in silico dissection of mixed phenotypes" docx

Báo cáo y học: " GeneChip analysis of human embryonic stem cell differentiation into hemangioblasts: an in silico dissection of mixed phenotypes" docx

... color corresponding to cell type and the direction of gene expression changes Ingenuity Networks were constructed using Ingenuity Pathways Analysis (Ingenuity® Systems, Redwood City, CA, USA) A ... GATA1(HBG1,hybridized in ESCsstemH1, Inc.).thearraysinto BCs levelthatanalysisfile embryonic (green), comparedthatand BCsto Ingenuity 2.0 file 2.0othertohumangenes that as ofarrays(Affyme...

Ngày tải lên: 14/08/2014, 08:20

19 360 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration

Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration

... plating of hESC-derived chondrogenic cells Fig 17 Chondrogenic differentiation capability of hESC-derived chondrogenic cells Fig 18 Analysis of pluripotency and lineage- restriction of hESC-derived chondrogenic ... explored for their potential as viable cell sources for cartilage tissue engineering (Chung et al., 2008) Human embryonic stem cells (hES...

Ngày tải lên: 11/09/2015, 09:57

190 475 0
Establishment of autologous culture systems for human embryonic stem cells

Establishment of autologous culture systems for human embryonic stem cells

... sources, named embryonic stem cells Literature review (ESCs), embryonic germ cells, fetal stem cells, umbilical cord stem cells, adult stem cells and induced pluripotent stem (iPS) cells (Ariff ... cell source for future clinical applications Literature review Table Characterization of stem cells by derivation source Category Embryonic stem cells Embryoni...

Ngày tải lên: 11/09/2015, 10:00

214 481 0
Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives

Role of sonic hedgehog signalling in human embryonic stem cells and its neural derivatives

... culture feeding 3.2.3 Human embryonic stem cells and induced pluripotent stem cells Human embryonic stem cell line HES-3 (46, XX) was from ES Cell International (Singapore, http://www.escellinternational.com) ... forebrain, midbrain, hindbrain and the spinal cord This figure was reproduced from Epstein et al., 1999 2.4 SHH and neural development During the initial ph...

Ngày tải lên: 11/09/2015, 10:14

178 549 0
Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

Báo cáo khoa học: Recruitment of transcription complexes to the b-globin locus control region and transcription of hypersensitive site 3 prior to erythroid differentiation of murine embryonic stem cells docx

... for the HS4 core enhancer (HS4), a region 5¢- to HS3 (5¢HS3), the core of HS3 (HS3), a region flanking HS2 and HS3 (3 ⁄ flank), the core of HS2 (HS2), a region downstream of HS2 (3 HS2), and the ... progenitor cells Discussion B Fig Transcription of LCR hypersensitive site in undifferentiated murine embryonic stem cells and in human CD 133 + bone m...

Ngày tải lên: 07/03/2014, 12:20

10 422 0
Atlas of Human Pluripotent Stem Cells doc

Atlas of Human Pluripotent Stem Cells doc

... culture, expansion and manipulation of human pluripotent stem cells The culmination of two events has enabled the production of human embryonic stem cells: the birth of the first IVF test-tube baby ... summarizing 12 years of our team’s experience, skill and knowledge in the derivation, culture and expansion of human embryonic stem cells, and more recently, of...

Ngày tải lên: 22/03/2014, 09:20

157 585 0
Từ khóa:
w