Intestine of zebrafish regionalization, characterization and stem cells

Intestine of zebrafish regionalization, characterization and stem cells

Intestine of zebrafish regionalization, characterization and stem cells

... Significance of the study of the digestive system 1.5 Intestinal stem cells 1.5.1 Location of intestinal stem cells 1.5.2 Intestinal stem cell number ... characteristics of the crypt-villus system 158 5.3.2 Determination of the number of epithelial stem cells in a 2D section of the inter-villi pocket of zebrafish (Danio rerio) intestine ... epithelial cells o...

Ngày tải lên: 11/09/2015, 10:04

270 347 0
Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

Báo cáo y học: "ntravenous transplantation of allogeneic bone marrow mesenchymal stem cells and its directional migration to the necrotic femoral head"

... intravenously injected into nude mice and the distribution and migration of MSCs were dynamically monitored to evaluate the feasibility and safety of intravenous implantation of allogeneic MSCs in the ... transplanted the bone marrow stem cells into the necrotic femoral heads, and results show bone marrow stem cells can remove vascular lesions...

Ngày tải lên: 25/10/2012, 11:18

10 585 0
Báo cáo y học: " Over-expression of HO-1 on mesenchymal stem cells promotes angiogenesis and improves myocardial function in infarcted myocardium" pdf

Báo cáo y học: " Over-expression of HO-1 on mesenchymal stem cells promotes angiogenesis and improves myocardial function in infarcted myocardium" pdf

... daily intraperitoneal injection of the HO-1 inhibitor zinc-protoporphyrin (ZnPP, Porphyrin Products, Logan, UT, USA) at a concentration of 50 μmol/kg/day, starting two days before and continuing ... et al.: Over-expression of HO-1 on mesenchymal stem cells promotes angiogenesis and improves myocardial function in infarcted myocardium Journal of Biomedic...

Ngày tải lên: 10/08/2014, 05:21

8 422 0
Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

Báo cáo y học: " High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells." ppsx

... this article as: Yang et al.: High efficient isolation and systematic identification of human adipose-derived mesenchymal stem cells Journal of Biomedical Science 2011 18:59 Submit your next manuscript ... differentiation of cryopreserved human adipose-derived stem cells Cryobiology 2008, 57:18-24 Chen MY, Lie PC, Li ZL, Wei X: Endothelial differentiation of...

Ngày tải lên: 10/08/2014, 10:20

9 520 0
Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

Use of IPs cell derived neural stem cells as a cellular vehicle for glioma and breast cancer therapy

... status of gene therapy for glioma and breast cancer 22 1.4 Stem cells 1.4.1 Adult stem cells 1.4.1.1 Neural stem cells 1.4.2 Induced pluripotent stem cells 1.5 Stem cell as a vehicle for cancer ... primers as follows: was performed using the forward and reverse CodA, GCGGAATTCATGAGCAATAACGCTTTAC -3’ (forward) and 5’ACGCTCGAGTCAACGTTTGTAATCGA...

Ngày tải lên: 09/09/2015, 18:56

134 439 0
Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration

Differentiation and derivation of lineage committed chondroprogenitors and chondrogenic cells from human embryonic stem cells for cartilage tissue engineering and regeneration

... plating of hESC-derived chondrogenic cells Fig 17 Chondrogenic differentiation capability of hESC-derived chondrogenic cells Fig 18 Analysis of pluripotency and lineage- restriction of hESC-derived chondrogenic ... explored for their potential as viable cell sources for cartilage tissue engineering (Chung et al., 2008) Human embryonic stem cells (hES...

Ngày tải lên: 11/09/2015, 09:57

190 475 0
báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot

báo cáo hóa học:"Transplantation of selected or transgenic blood stem cells – a future treatment for HIV/AIDS?" pot

... the American Foundation for AIDS Research (amfAR) for providing the international collaboration for our research group This workshop was supported by an unrestricted grant from Pfizer Pharma GmbH, ... utilization of health-care resources Therapy with CCR5-negative stem cells In the early 1980s, alloHSCT appeared to be attractive as a therapy for HIV in patients with advanced d...

Ngày tải lên: 20/06/2014, 08:20

5 208 0
Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

Báo cáo khoa học: " Effect of dihydrotestosterone on mouse embryonic stem cells exposed to H2O2-induced oxidative stress" pdf

... phosporylation of MAPKs proteins may result in the prevention of downstream events such as activation of NF-κB [44] Therefore, we suggest that the Effect of dihydrotestosterone on mouse embryonic stem cells ... sodium-nucleoside transport system in brush border membrane vesicles from human kidney Pharm Res 1993, Effect of dihydrotestosterone on mouse embryonic...

Ngày tải lên: 07/08/2014, 20:23

10 264 0
Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf

Báo cáo y học: "Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions" pdf

... Sphingosine-1-phosphate promotes the differentiation of human umbilical cord mesenchymal stem cells into cardiomyocytes under the designated culturing conditions Journal of Biomedical Science 2011 ... have successfully produced both neonatal cardiac myocyte and cardiomyocytes sheets from differentiated human umbilical cord mesenchymal stem cells...

Ngày tải lên: 10/08/2014, 05:21

9 263 0
Báo cáo y học: "Preferential expression of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung. An FFPE proteomic study" pptx

Báo cáo y học: "Preferential expression of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung. An FFPE proteomic study" pptx

... of potential markers for cancer stem cells in large cell neuroendocrine carcinoma of the lung An FFPE proteomic study Journal of Clinical Bioinformatics 2011 1:23 Submit your next manuscript to ... upon Tyne, U.K.), polyclonal rabbit anti CGA antibody (DAKO Japan, Kyoto, Japan) and monoclonal mouse anti SYN antibody (DAKO Japan, Kyoto, Japan) The staining...

Ngày tải lên: 10/08/2014, 09:22

13 376 0
Báo cáo y học: "Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis" pps

Báo cáo y học: "Therapeutic potential of human umbilical cord mesenchymal stem cells in the treatment of rheumatoid arthritis" pps

... using the corresponding inhibitors They included 1-MT (1 mM), an inhibitor of IDO enzymatic activity, INDO (5 μM), an inhibitor of PGE2 synthesis, L-NAME (1 mM), a specific inhibitor of NO synthase, ... Notably, delayed addition of UC-MSCs maintained such inhibitory effects, suggesting that the transplantation of these cells is practicable and effective for treatment of RA...

Ngày tải lên: 12/08/2014, 15:22

13 297 0
Báo cáo khoa học: " Early changes of CD4-positive lymphocytes and NK cells in patients with severe Gram-negative sepsis" ppt

Báo cáo khoa học: " Early changes of CD4-positive lymphocytes and NK cells in patients with severe Gram-negative sepsis" ppt

... percentage of NK cells are shown in Figure Patients with NK cells >20% survived longer compared with those patients with NK cells ≤20% (P = 0.041) Twenty-four out of 38 patients with NK cells ≤20% ... present study investigated whether changes of lymphocytes and NK cells occur early in severe sepsis A cohort of patients with severe...

Ngày tải lên: 13/08/2014, 03:20

7 225 0
Differentiation of bone marrow derived mesenchymal stem cells (BM MSCs) using engineered nanofiber substrates

Differentiation of bone marrow derived mesenchymal stem cells (BM MSCs) using engineered nanofiber substrates

... Types of cells used in bone tissue engineering for osteogenic differentiation 59 2.3.1 Potential of mesenchymal stem cells (MSCs) for bone healing 60 2.3.2 Potential of bone marrow derived mesenchymal ... Casey K Chan Effects of mechanical stimulation in osteogenic and chondrogenic differentiation of bone marrow- derived mesenchymal stem cells on...

Ngày tải lên: 11/09/2015, 09:57

241 446 0
Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps

Báo cáo khoa học: " Isolation and characterization of canine umbilical cord blood-derived mesenchymal stem cells" pps

... the canine umbilical cord blood is attractive In conclusion, this study provides a simplified isolation and characterization procedure for mesenchymal stem cells derived from canine umbilical cord ... was measured and calculated and drawn as a graph A Fig Identification of the cumulative population doubling level (CPDL) and culture of canine umbilical cord...

Ngày tải lên: 07/08/2014, 23:22

7 440 0
Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection

Characterization of the secretion of mesenchymal stem cells and its relevance to cardioprotection

... CHARACTERIZATION OF THE SECRETION OF MESENCHYMAL STEM CELLS AND ITS RELEVANCE TO CARDIOPROTECTION LAI RUENN CHAI (B.Eng (Hons.)), NTU A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY ... identified Thesis The specific aims of this PhD project were to identify the active cardioprotective factor of the MSCs secretion and to elucidate t...

Ngày tải lên: 10/09/2015, 08:42

161 351 0
w