Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons 2

Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons 2

Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons 2

... 0.057 0. 128 0 .21 8 0.3 32 0.437 0.549 0.6 72 0.855 0.981 1.1 62 1.358 1.5 72 1.780 1.981 2. 2 02 2.4 12 0.0 12 0. 022 0.034 0.045 0.055 0.063 0.0 72 0.0 82 0.089 0.097 0.105 0.113 0. 120 0. 126 0.1 32 0.137 ... 0.143 0 .24 2 0.343 0.443 0.550 0.699 0.838 0.997 1 .20 5 1.401 1.601 1.799 2. 008 2. 207 2. 406 0.010 0. 022 0.0 32 0.041 0.049 0.057 0.066 0.074 0.0 82 0.091 0.099...

Ngày tải lên: 10/09/2015, 15:54

13 196 0
Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons

Experimental and theoretical studies on adsorbed natural gas storage system using activated carbons

... EXPERIMENTAL AND THEORETICAL STUDIES ON ADSORBED NATURAL GAS STORAGE SYSTEM USING ACTIVATED CARBONS KAZI AFZALUR RAHMAN (B.Sc in Mechanical Engineering, ... Saha, W.G Chun, K.C Ng, Theoretical modeling and simulation for adsorbed natural gas storage system using activated carbon, Proceedings of the 9th International Conference on Sustainable Energ...

Ngày tải lên: 10/09/2015, 15:54

209 290 0
Experimental and theoretical studies on adsorption chillers driven by waste heat and propane

Experimental and theoretical studies on adsorption chillers driven by waste heat and propane

... Introduction 1.1 Background 1.1.1 Heat Sorption Systems and Global Concerns on the Environment and Ecology 1.1.2 Limitations of Adsorption Chillers 1.1.3 Propane ... Choon Ng, and Wongee Chun "Pressurized Adsorption Cooling Cycles Driven by Solar /Waste Heat. " Applied Thermal Engineering (2014) Li, Ang, Ismail, Azhar Bin, Kyaw Thu, Kim Choon Ng, and Wai Soong ... s...

Ngày tải lên: 12/09/2015, 11:05

294 284 0
Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

Báo cáo y học: "Interaction of mumps virus V protein variants with STAT1-STAT2 heterodimer: experimental and theoretical studies" pps

... infection by inhibition of IFN signaling and blocking of the antiviral response [17] In this study we analyzed two variants of mumps virus V protein (VWT and VGly) derived from Urabe AM9 vaccine ... position 156 in the V protein (VGly) of HN-G1081 virus variant, whereas resistance to IFN was associated with preservation of wild-type phenotype in the V protei...

Ngày tải lên: 12/08/2014, 01:22

10 313 0
Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

Experimental and theoretical studies of waste heat driven pressurized adsorption chillers

... Figure 5.40 Temperature profiles of major components of the waste- heat driven pressurized adsorption chiller with input heat flux of 2.75 W cm-2 147 Figure 5.41 Effects of operation time on chiller ... variation of the heat of adsorption as a function of loading, which in turn depends on the pressure and temperature at which adsorption/ desorption occurs The...

Ngày tải lên: 11/09/2015, 10:01

221 833 0
Experimental and numerical studies on the viscoelastic behavior of living cells

Experimental and numerical studies on the viscoelastic behavior of living cells

... Literature review 17 contribution of the cell membrane and spectrin network to the large deformation of red cells On the other hand, the continuum modeling approach treats the cell as a continuum material ... EXPERIMENTAL AND NUMERICAL STUDIES ON THE VISCOELASTIC BEHAVIOR OF LIVING CELLS ZHOU ENHUA (B.Eng., WUHEE & M.Eng., WHU) A THESIS SUBMITTED FOR...

Ngày tải lên: 12/09/2015, 11:01

191 275 0
Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

Experimental realization and theoretical studies of novel all optical devices based on nano scale waveguides

... semiconductor -based all- optical switches include semiconductor optical amplifier (SOA) and more recently silicon photonics Implementation of ultrafast silicon photonic switch is largely based on ... principles and switching operations of EUPT and EDPT 2.1.1 Energy-up photonic transistor based on AMOI scheme The all- optical operation of EUPT adopts the Absorptio...

Ngày tải lên: 09/09/2015, 08:14

234 506 0
Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

Tài liệu Báo cáo khoa học: Structural and functional studies on a mesophilic stationary phase survival protein (Sur E) from Salmonella typhimurium ppt

... template using Deep Vent DNA polymerase (New England Biolabs, Ipswich, MA, USA), a sense primer (CATATGGCTAGC ATGCGCATATTGCTGAGTAAC) containing an NheI site and an antisense primer (TTAGGATCCTTACCATTGCG ... Salmonella typhimurium SurE A Pappachan et al phase and under conditions of high temperature and high salt compared with parent strains that had the intact surE gene [1] Th...

Ngày tải lên: 18/02/2014, 14:20

10 560 0
Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

Tài liệu Báo cáo khoa học: Structure determination and biochemical studies on Bacillus stearothermophilus E53Q serine hydroxymethyltransferase and its complexes provide insights on function and enzyme memory doc

... Crystal structure of E53QbsSHMT and its complexes Table Data collection statistics of E53QbsSHMT and its complexes Values in parantheses correspond to highest resolution bin Ligand(s) used None Gly ... belonged to the P21212 space group and contained one monomer in the asymmetric unit Cell dimensions and details of data collection are shown in Table Expression and purificat...

Ngày tải lên: 18/02/2014, 16:20

13 518 0
Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

Báo cáo khoa học: H2O2, but not menadione, provokes a decrease in the ATP and an increase in the inosine levels in Saccharomyces cerevisiae An experimental and theoretical approach pot

... described in Materials and methods H2O2 evokes a decrease and an increase in the intracellular concentration of ATP and inosine, respectively Searching for the rationale for these phenomena, possible ... degradation and the appearance of intermediate products were essentially the same in both cases and, above all, no appreciable differences in the rates o...

Ngày tải lên: 17/03/2014, 10:20

12 506 0
Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

Báo cáo khoa học: Structural and serological studies on a new 4-deoxy-D-arabino-hexosecontaining O-specific polysaccharide from the lipopolysaccharide of Citrobacter braakii PCM 1531 (serogroup O6) pptx

... Part of a two-dimensional 1H,13C HSQC spectrum of the O-specific polysaccharide (OPS) of Citrobacter braakii PCM 1531 One-dimensional 1H and 13C NMR spectra are displayed along the horizontal and ... immunodiffusion of anti (Citrobacter braakii PCM 1531) serum (A) and anti- (Citrobacter PCM 1487) serum (B) with lipopolysaccharide (LPS)-I (well 1) and...

Ngày tải lên: 23/03/2014, 17:22

7 480 0
Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

Combustion and emission characteristics of a natural gas fueled diesel engine with EGR

... of engine parameters on performance and emissions of a pilot ignited natural gas diesel engine Energy 2010;35:1129–38 [11] Wannatong K, Akarapanyavit N, Siengsanorh S, Chanchaona S Combustion and ... A2 T þ A3 T þ A4 T þ Þ ð5Þ [16] Mbarawa M, Milton BE, Casey RT Experiments and modeling of natural gas Cp ¼ð where (A0 ), (A1 ), (A2 ), (A3 ), and (A4 ) are con...

Ngày tải lên: 15/06/2014, 09:26

15 575 0
Báo cáo toán học: "Antioxidant, antimicrobial, and theoretical studies of the thiosemicarbazone derivative Schiff base 2-(2-imino-1-methylimidazolidin-4-ylidene)hydrazinecarbothioamide (IMHC)" potx

Báo cáo toán học: "Antioxidant, antimicrobial, and theoretical studies of the thiosemicarbazone derivative Schiff base 2-(2-imino-1-methylimidazolidin-4-ylidene)hydrazinecarbothioamide (IMHC)" potx

... Antioxidant, antimicrobial, and theoretical studies of the thiosemicarbazone derivative Schiff base 2-(2-imino-1-methylimidazolidin-4- ylidene)hydrazinecarbothioamide ... across the C=N bond The existence of the thione form predominantly in the solid state is demonstrated by the presence of two absorption bands at 1273.7 and 3421 cm−1 belonging to the C=S...

Ngày tải lên: 20/06/2014, 20:20

23 450 1
w