Improving visual search performance in augmented reality environments using a subtle cueing approach experimental methods, apparatus development and evaluation

Improving visual search performance in augmented reality environments using a subtle cueing approach experimental methods, apparatus development and evaluation

Improving visual search performance in augmented reality environments using a subtle cueing approach experimental methods, apparatus development and evaluation

... Identify a classical problem in AR that involves Visual Search Study and understand Visual Search in the traditional human attention domain, as well as the domain of AR Search for empirical experiment ... reaching that solution Chapter discusses how Subtle Cueing can be investigated, including the claims and variables to be examined as required for the evaluation of...

Ngày tải lên: 10/09/2015, 09:13

125 394 0
Báo cáo hóa học: " Viewing medium affects arm motor performance in 3D virtual environments" pdf

Báo cáo hóa học: " Viewing medium affects arm motor performance in 3D virtual environments" pdf

... doi:10.1186/1743-0003-8-36 Cite this article as: Subramanian and Levin: Viewing medium affects arm motor performance in 3D virtual environments Journal of NeuroEngineering and Rehabilitation 2011 8:36 Submit your next ... 0.05 Since we were interested in the effects of the viewing media on movement performance, significant interactions involving the viewing media were...

Ngày tải lên: 19/06/2014, 08:20

9 325 1
Báo cáo sinh học: " Research Article Employing Second-Order Circular Suprasegmental Hidden Markov Models to Enhance Speaker Identification Performance in Shouted Talking Environments" potx

Báo cáo sinh học: " Research Article Employing Second-Order Circular Suprasegmental Hidden Markov Models to Enhance Speaker Identification Performance in Shouted Talking Environments" potx

... implementing, and testing new models to enhance text-dependent speaker identification performance in shouted talking environments The new proposed models are called Second-Order Circular Suprasegmental ... First-Order Left -to- Right Suprasegmental Hidden Markov Models First-Order Left -to- Right Suprasegmental Hidden Markov Models have been derived fr...

Ngày tải lên: 21/06/2014, 16:20

10 365 0
Key areas, causes of FDI firm performance in binh duong industrial zones a qualitative approach

Key areas, causes of FDI firm performance in binh duong industrial zones a qualitative approach

... KEY AREAS, CAUSES OF FDI FIRM PERFORMANCE IN BINH DUONG INDUSTRIAL ZONES A qualitative approach In Partial Fulfillment of the Requirements of the Degree of MASTER OF BUSINESS ADMINISTRATION In ... were asked about their own evaluation of in business performance and differentiation advantage or cost advantage of firms in Binh Duong in g...

Ngày tải lên: 23/10/2015, 15:38

88 285 0
Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

Estimation of Proper Strain Rate in the CRSC Test Using a Artificial Neural Networks

... involved gathering the data for use in training and testing the neural network A large training data reduces the risk of under-sampling the nonlinear function, but increases the training time ... learn the database, and to predict the properties of consolidation SELECTION OF STRAIN RATE r= V − Vmin Vmax − Vmin Data Collection Data Normalization Parametric Studies...

Ngày tải lên: 22/03/2013, 15:01

5 520 1
Báo cáo khoa học: "Enhancing Unlexicalized Parsing Performance using a Wide Coverage Lexicon, Fuzzy Tag-set Mapping, and EM-HMM-based Lexical Probabilities" ppt

Báo cáo khoa học: "Enhancing Unlexicalized Parsing Performance using a Wide Coverage Lexicon, Fuzzy Tag-set Mapping, and EM-HMM-based Lexical Probabilities" ppt

... is applicable in any setting in which there exist a small treebank and a wide- coverage lexical resource For example parsing Arabic using the Arabic Treebank and the Buckwalter analyzer, or parsing ... in a more realistic one in which parsing and segmentation are handled jointly by the parser (Goldberg and Tsarfaty, 2008) (Sec 5) External lexical information enhan...

Ngày tải lên: 17/03/2014, 22:20

9 330 0
Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx

Báo cáo hóa học: " Quantification of the effects of an alpha-2 adrenergic agonist on reflex properties in spinal cord injury using a system identification technique" pptx

... because of their time constraints, and their data are not included here Patients had sustained a traumatic, motor incomplete non-progressive spinal cord injury, with an American Spinal Injury Association ... referred the patients and participated in interpreting data, and WZR participated in interpreting data and writing the manuscript All authors read and approved the...

Ngày tải lên: 19/06/2014, 08:20

7 468 0
Báo cáo lâm nghiệp: "Hourly and daily variations of xylem sapflow in sweet chestnut coppices using a thermal measurement method" ppsx

Báo cáo lâm nghiệp: "Hourly and daily variations of xylem sapflow in sweet chestnut coppices using a thermal measurement method" ppsx

... reveals an apparent limit to forest transpiration Daily variations of sapflow F and Ep are shown in Fig Because of a particularly wet season, no water stress was found during 1987 The maximum transpiration ... Figs and show an influence of net radiation on sapflow variations With a daily time step, transpiration T is about equal to sapflow, as was shown by mea- we...

Ngày tải lên: 09/08/2014, 04:20

3 198 0
Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx

Báo cáo khoa học: " The effect on the small bowel of 5-FU and oxaliplatin in combination with radiation using a microcolony survival assay" pptx

... histological analysis: radiation alone (n = 4), 5-FU alone (n = 1), oxaliplatin alone (n = 6), radiation + 5-FU (n = 2), radiation + oxaliplatin (n = 3), radiation + 5-FU + oxaliplatin (n = 2) and 5-FU ... mucosal stem cells The aim of this study was to study the bowel damage caused by radiation, 5-FU or oxaliplatin as well as combinations thereof by usin...

Ngày tải lên: 09/08/2014, 10:20

7 300 0
báo cáo khoa học: "Topoisomerase II alpha gene copy loss has adverse prognostic significance in ERBB2-amplified breast cancer: a retrospective study of paraffin-embedded tumor specimens and medical charts" ppsx

báo cáo khoa học: "Topoisomerase II alpha gene copy loss has adverse prognostic significance in ERBB2-amplified breast cancer: a retrospective study of paraffin-embedded tumor specimens and medical charts" ppsx

... Topoisomerase IIalpha gene amplification predicts favorable treatment response to tailored and dose-escalated anthracycline-based adjuvant chemotherapy in HER-2/neu-amplified breast cancer: Scandinavian ... Prognostic significance of Ki-67 and topoisomerase II expression in infiltrating ductal carcinoma of the breast a multivariate analysis of 863 cases Breast C...

Ngày tải lên: 10/08/2014, 22:20

10 378 0
báo cáo khoa học: " Understanding multinational companies in public health systems, using a competitive advantage framework Jane Lethbridge" doc

báo cáo khoa học: " Understanding multinational companies in public health systems, using a competitive advantage framework Jane Lethbridge" doc

... world of the multinational health care company, through a competitive advantage framework As the number of health care multinational companies involved in public healthcare systems is growing slowly, ... shares to Fortis International, an Indian health care company, interested in international expansion Within weeks, Khazanah Nasional Berhad, the Malaysian government...

Ngày tải lên: 11/08/2014, 14:21

10 348 0
Báo cáo y học: " Relationships among neurocognition, symptoms and functioning in patients with schizophrenia: a path-analytic approach for associations at baseline and following 24 weeks of antipsychotic drug therapy" ppt

Báo cáo y học: " Relationships among neurocognition, symptoms and functioning in patients with schizophrenia: a path-analytic approach for associations at baseline and following 24 weeks of antipsychotic drug therapy" ppt

... domains of functioning (i.e., QLS Instrumental, QLS Intrapsychic, and QLS Interpersonal) at baseline and following 24 weeks of antipsychotic drug therapy in patients with schizophrenia In our path-analytic ... Table The majority of patients were male with an average age of approximately 39 years of age The average age of onset of the disease was...

Ngày tải lên: 11/08/2014, 17:20

12 276 0
báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx

báo cáo khoa học: " Identification of amino acid residues involved in substrate specificity of plant acyl-ACP thioesterases using a bioinformatics-guided approach" pptx

... ATAGAAACCGTCGCAAATCATCTGCAGG CCTGCAGATGATTTGCGACGGTTTCTAT TAATCATGTTCAGACTGCTGGATTGCTTGG CCAAGCAATCCAGCAGTCTGAACATGATTA GATATGGGTTACTACTCGTATGC GCATACGAGTAGTAACCCATATC GGAAAGAATGGTACTCGTCGTGATTGGCT AGCCAATCACGACGAGTACCATTCTTTCC ... Q9SQ13 Fat A FatB Figure The FatA and FatB classes of plant acyl-ACP thioesterasess The FatA and FatB classes of plant acyl-ACP thioesterases Enzym...

Ngày tải lên: 12/08/2014, 05:20

11 246 0
Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

Báo cáo sinh học: "Decrease in Shiga toxin expression using a minimal inhibitory concentration of rifampicin followed by bactericidal gentamicin treatment enhances survival of Escherichia coli O157: H7-infected BALB/c mice" pdf

... that limit toxin expression followed by gentamicin at bactericidal doses to eradicate the bacterial agent Page of The minimum inhibitory concentration (MIC) and minimum bactericidal concentration ... Appl Res 2003, 3:137-143 19 Rahal EA, Kazzi N, Kanbar A, Abdelnoor AM, Matar GM: Role of rifampicin in limiting Escherichia coli O157:H7 Shiga- like toxin exp...

Ngày tải lên: 12/08/2014, 17:20

7 282 0
Báo cáo y học: "Disruption of cell wall fatty acid biosynthesis in Mycobacterium tuberculosis using a graph theoretic approach" pptx

Báo cáo y học: "Disruption of cell wall fatty acid biosynthesis in Mycobacterium tuberculosis using a graph theoretic approach" pptx

... can be generated in D Deleting this set Figure Fatty acid Biosynthesis (Source KEGG pathway database) Fatty Acid Synthesis Pathway in Mycobacterium tuberculosis H37rv The pathway was downloaded ... India Authors’ contributions VB contributed in pathway modelling, programming and applying graphs in biology UR analysed the biological data TK was involved in applying gra...

Ngày tải lên: 13/08/2014, 16:20

13 345 0
w