Mechanical characterization and modeling of polymerclay nanocomposites

Mechanical characterization and modeling of polymerclay nanocomposites

Mechanical characterization and modeling of polymerclay nanocomposites

... MECHANICAL CHARACTERIZATION AND MODELING OF POLYMER/CLAY NANOCOMPOSITES SONG SHAONING (B.ENG) A THESIS SUBMITTED FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MECHANICAL ENGINEERING ... illustration of crack initiation and propagation in the epoxy/clay nanocomposites Figure 1.3 Mechanical properties of the epoxy/S-clays and the nylon 6/clay nanocomposit...

Ngày tải lên: 09/09/2015, 11:20

157 414 0
Báo cáo y học: "Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strain" potx

Báo cáo y học: "Characterization and modeling of the Haemophilus influenzae core and supragenomes based on the complete genomic sequences of Rd and 12 clinical nontypeable strain" potx

... biofilms on the respiratory mucosa of humans and other mammals and it has been hypothesized that this contributes to the chronicity of these infections [1,2] They are the most frequently detected ... appear only once in the entire global population The model requires four parameters: the number of core genes, the number of contingency genes, the probability of...

Ngày tải lên: 14/08/2014, 07:21

18 509 0
Characterization and modeling of microwave spiral inductors and transformers

Characterization and modeling of microwave spiral inductors and transformers

... this thesis, several kinds of on-chip microwave spiral inductors are analyzed and modeled Some novel predictions of the series resistance and inductance of general spiral inductors are presented ... density xv D Outer dimension of spiral inductor d Inner dimension of spiral inductor W Metal width of spiral inductor T Metal thickness of spiral inductor P Met...

Ngày tải lên: 12/09/2015, 09:42

172 620 0
Fabrication, characterization, and modeling of silicon multi gate devices

Fabrication, characterization, and modeling of silicon multi gate devices

... perspective of the nano-scale multi- gate transistor devices based on extensive process and device simulation study Impact of fringing field, the dimension and material of spacer and the gate dielectric ... at the terminals of the test key for measuring the I-V characteristics of the N and P drivers and the DUT, and, the C-V measurement of N and P-type SNW DUTs...

Ngày tải lên: 12/09/2015, 11:29

172 346 0
Characterization and modeling of MOSFETS for RF applications

Characterization and modeling of MOSFETS for RF applications

... Figure Plot of ybd from SD and SD-R in off-state (VGS=0V and VBS=0V) 86 Figure 6 Plot of ybs from SD and SD-R in off-state (VGS=VBS=0V and VDS=3.2V) 87 Figure Real part of ygg from GD and GS (“_pd” ... complete characterization of the MOSFET in the three-port form, extract its terminal charges as a function both bias and frequency and thus facilitate its large-signal...

Ngày tải lên: 03/10/2015, 20:31

164 309 0
Characterization and deactivation of sulfided red mud used as hydrogenation catalyst

Characterization and deactivation of sulfided red mud used as hydrogenation catalyst

... of the activity and selectivity of red mud used as a catalyst for the hydrogenation of anthracene oil was studied Reactions were carried out at constant temperature, pressure and flow-rates Catalyst ... composition of the red mud can be found in Table Sulfided red mud catalytic activity was tested by hydrogenating a light fraction of anthracene oil suppli...

Ngày tải lên: 23/09/2012, 14:46

15 514 0
Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

Tài liệu Báo cáo khoa học: Preliminary molecular characterization and crystallization of mitochondrial respiratory complex II from porcine heart ppt

... al Characterization of respiratory complex II Fig Sequencing of porcine heart mitochondrial complex II Total RNA was extracted and purified from the fresh porcine heart, and genes of four complex ... sequencing and crystallization of mitochondrial complex II from porcine heart Characterization of respiratory complex II be the case...

Ngày tải lên: 19/02/2014, 02:20

6 469 0
Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

Tài liệu Báo cáo khoa học: Physico-chemical characterization and synthesis of neuronally active a-conotoxins docx

... characterization of native a-conotoxins Analysis of neuronally active a-conotoxins using HPLC and MS, including identification of post-translational modifications Isolation and identification Standard procedures ... 2004 Characterization and synthesis of a-conotoxins (Eur J Biochem 271) 2299 Fig LC/MS analysis of crude venom from C geographus Example of experime...

Ngày tải lên: 19/02/2014, 12:20

11 556 0
Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

Tài liệu Báo cáo khoa học: Characterization and mode of action of an exopolygalacturonase from the hyperthermophilic bacterium Thermotoga maritima doc

... Molecular and biochemical characterisation of the thermo-active family pectate lyase from the hyperthermophilic bacterium Thermotoga maritima Biochem J 370, 651659 21 Kozianowski G, Canganella F, ... as the rst and only product on PGA and oligoGalpA On the basis of its mode of action, PelB should be classied as an exopolygalacturonase (EC 3.2.1.67) To date...

Ngày tải lên: 20/02/2014, 03:20

10 594 0
Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

Tài liệu Báo cáo Y học: Characterization and regulation of yeast Ca2+-dependent phosphatidylethanolamine-phospholipase D activity docx

... cytosolic and membranebound PtdEtn-PLD activity Cytosolic and membrane-bound fractions were prepared as described in Materials and methods PtdEtn-PLD activity measured without addition of EDTA, ... characterized the cytosolic and membrane-bound forms of yeast PtdEtn-PLD and examined the regulation of PtdEtn-PLD activity under certain growth, nutritional and stress...

Ngày tải lên: 22/02/2014, 07:20

10 499 0
Characterization and Authentication of Olive and Other Vegetable Oils pptx

Characterization and Authentication of Olive and Other Vegetable Oils pptx

... Aceite de la Comunitat Valenciana Aceite de Madrid Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Andalucía Extremadura Extremadura Castilla-La ... 10.1 Development of Methods for the Determination of Ts and T3s in Vegetable Oils 10.2 Development of Methods for the Determination of Sterols in Vegetable Oils ... and free...

Ngày tải lên: 07/03/2014, 21:20

228 768 0
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt

... number of protein toxins have been purified and characterized from snake venoms [1,2] and snake venoms typically contain from 30 to over 100 protein toxins Some of these proteins exhibit enzymatic ... shown Enzymatic toxins from snake venom monomeric counterparts ncHdPLA2s were isolated from Crotalinae and Viperinae snakes They consist of a basic toxic PLA2...

Ngày tải lên: 14/03/2014, 22:20

33 436 0
Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

Báo cáo khoa học: Characterization and regulation of a bacterial sugar phosphatase of the haloalkanoate dehalogenase ppt

... ARA456 ARA457 ARA458 ARA459 ARA460 ARA477 ARA486 ARA487 ARA509 ARA510 ARA514 ARA515 CCTATTGAATTCAAAAGCCGG TAACCCCAATCTAGACAGTCC CTGCTGTAATAATGGGTAGAAGG GGAATTCCATATGCGTATTATGGCCAG TATTTACTCGAGAATCCCCTCCTCAGC ... TATTTACTCGAGAATCCCCTCCTCAGC CGGGATCCACCGTGAAAAAGAAAGAATTGTC GAATTCATAAAGAAGCTTTGTCTGAAGC CGGCGCGTCATATGGCCAGTCATGATA TGATACGCATATGTCACCGGCTGGC CTCAGCCAATTTGGTTACATCCTTGTCCAAGTCAATCAGA...

Ngày tải lên: 14/03/2014, 23:20

14 594 0
Báo cáo Y học: Synthesis, characterization and application of two nucleoside triphosphate analogues, GTPcNH2 and GTPcF pdf

Báo cáo Y học: Synthesis, characterization and application of two nucleoside triphosphate analogues, GTPcNH2 and GTPcF pdf

... lower hydrolysis rates were the two triphosphate analogues with b,c-substitutions GppCH2p and GppNHp The Ras-catalysed hydrolysis rate of GTPcNH2 finally lay midway between the rates for GTPcS and ... c-Fluoroadenosine triphosphate Synthesis, properties, and interaction with myosin and heavy meromyosin Biochemistry 11, 2863–2871 34 Pfeuffer, T & Eckstein, F (1976) Topology...

Ngày tải lên: 18/03/2014, 01:20

9 543 0
w