Use of formic acid formates as hydrogen source for reactions

Use of formic acid formates as hydrogen source for reactions

Use of formic acid formates as hydrogen source for reactions

... production of -valerolactone, a sustainable liquid for carbon-based chemicals for energy, from biomass-derived levulinic acid and formic acid was reported The use of formic acid as the hydrogen ... Great efforts have been made to study and improve the hydrogen production from formic acid/ formates decomposition Focus has been more on formic acid than format...

Ngày tải lên: 09/09/2015, 10:15

220 341 0
The use of the Internet tool as an assistance for first-year non-major students at Namdinh University of Technology Education in basic English self-study

The use of the Internet tool as an assistance for first-year non-major students at Namdinh University of Technology Education in basic English self-study

... studies the use of the Internet tool as an assistance for first-year non-major students at Namdinh University of Technology Education (NUTE) in basic English self-study That is the students use of ... developing as well The next is the intergrating technology especially the Internet with web-based activities into the syllabus u...

Ngày tải lên: 04/08/2015, 09:41

15 565 0
báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

báo cáo hóa học:" Use of Tranexamic acid is a cost effective method in preventing blood loss during and after total knee replacement" ppt

... data and writing the manuscript MU was involved in the overall supervision, preparation of the questionnaire and collection and analysis of data TA was involved in the study design, analysis and ... important factors that Table Different methods of blood conservation and their complications Alternatives used to avoid allogenic blood transfusions and their disadvantag...

Ngày tải lên: 20/06/2014, 04:20

5 452 0
Báo cáo hóa học: " Facile template-free synthesis of pine needle-like Pd micro/nano-leaves and their associated electro-catalytic activities toward oxidation of formic acid" pot

Báo cáo hóa học: " Facile template-free synthesis of pine needle-like Pd micro/nano-leaves and their associated electro-catalytic activities toward oxidation of formic acid" pot

... article as: Zhou et al.: Facile template-free synthesis of pine needle-like Pd micro/nano-leaves and their associated electro-catalytic activities toward oxidation of formic acid Nanoscale Research ... performance of as-prepared catalysts for the formic acid electro -oxidation The inset of Figure shows the CV of formic acid oxidation on the Pd...

Ngày tải lên: 21/06/2014, 03:20

6 546 0
Báo cáo y học: " Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase" pot

Báo cáo y học: " Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase" pot

... doi:10.1186/1743-422X-8-18 Cite this article as: Lee et al.: Characterization of thiobarbituric acid derivatives as inhibitors of hepatitis C virus NS5B polymerase Virology Journal 2011 8:18 Submit your next manuscript ... when screening a chemical library against HCV NS5B, we found a series of thiobarbituric acid compounds to be potent inhibitors of HCV N...

Ngày tải lên: 11/08/2014, 21:21

4 305 0
Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt

Báo cáo sinh học: "Use of the score test as a goodness-of-fit measure of the covariance structure in genetic analysis of longitudinal data" ppt

... improvement in the t of the environmental covariance was obtained when relaxing the assumption of constant residual variance, and was clearly shown in the score statistic values A much simpler model was ... parameters on the sub-diagonals and D is a diagonal matrix of the inverse of innovation variances Score and information matrices for D and L parameters ca...

Ngày tải lên: 14/08/2014, 13:22

14 328 0
Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

Báo cáo khoa học: Alternative splicing: regulation of HIV-1 multiplication as a target for therapeutic action docx

... UUAGGACAUAUAGUUAGCCCUAGG unknown UGGGU CUAGACUAGA CCAGUAGAUCCUAGACUAGA GAAGAAGCGGAGACAGCGACGAAGA AGAUCCAUUCGAUUAG unknown UAGUGAAUAGAGUUAGGCAGGGA GAAGAAGAA UAGAAGAAGAA 4995–5017 [5, 12, 38, 40] 5362–5366 ... coactivators J Virol 76, 9724–9734 HIV-1 alternative splicing regulation 34 Kuramitsu M, Hashizume C, Yamamoto N, Azuma A, Kamata M, Yamamoto N, Tanaka Y & Aida Y (2005) A novel...

Ngày tải lên: 06/03/2014, 09:22

10 435 0
Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx

Báo cáo Y học: Engineering and use of 32P-labeled human recombinant interleukin-11 for receptor binding studies docx

... Y. C & Yin, T.G (1992) Interleukin-11 and its receptor Biofactors 4, 15±21 Yin, T.G., Miyazawa, K & Yang, Y. C (1992) Characterization of interleukin-11 receptor and protein tyrosine phosphorylation ... regulation of production of pro-in¯ammatory cytokines such as TNF-a, IL-1b, IFN-c and IL-12 by monocytes [55,56], and that the IL-11 receptor analysis on human cell...

Ngày tải lên: 24/03/2014, 00:21

8 423 0
Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

Báo cáo khoa học: Molecular analysis of the interaction between cardosin A and phospholipase Da Identification of RGD/KGE sequences as binding motifs for C2 domains pdf

... 5¢-CATCTTGAAAGTCGGTGCGGGAGAAGCAA CACAATGC-3¢ (the reverse primer was the complementary sequence); pCA(E45 7A) forward primer, 5¢-CATCTTGA AAGTCGGTAAGGGAGCAGCAACACAATGC-3¢ (the reverse primer was the ... Simoes et al ˜ Cardosin A associates with phospholipase Da A Fig Cardosin A interacts with the C2 domain of PLDa Pull-down assays for cardosins A and B were per...

Ngày tải lên: 30/03/2014, 11:20

13 455 0
THE END OF OBSOLESCENCE :THE WEB AS GROUND ZERO FOR THE POST-CONSUMER ECONOMY

THE END OF OBSOLESCENCE :THE WEB AS GROUND ZERO FOR THE POST-CONSUMER ECONOMY

... relationship to information A THOUGHT EXPERIMENT THE DIAMOND AGE The Universal Copymachine Physics + Culture at the heart of the problem THE BUFFALO CULTURE Doing More in the Land of Less USING THE WHOLE ... 1254-1325 “BEATUS” MAP CATALAN ATLAS 1375 PTOLEMY 90-168 RISE OF THE MERCHANT CLASS THE AGE OF EXPLORATION THE RISE OF DEMOCRACY MANIFEST DESTINY ASPIRATIONA...

Ngày tải lên: 03/06/2014, 18:27

65 289 0
Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

Báo cáo sinh học: " The Israeli strain IS-98-ST1 of West Nile virus as viral model for West Nile encephalitis in the Old World" pdf

... study was limited in its scope, the results indicate that WNV strain IS-98-ST1 is suitable as viral model for West Nile encephalitis in the Old World The Israeli strain IS-98-ST1 that caused the ... the fact that an Israeli WNV strain was introduced in New York City in 1999 [4] The murine model of WNV-associated encephalitis has been wid...

Ngày tải lên: 18/06/2014, 22:20

5 406 0
Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

Báo cáo hóa học: " Use of Time-Frequency Analysis and Neural Networks for Mode Identification in a Wireless Software-Defined Radio Approach" pptx

... design of mode identification strategies for reconfigurable software-defined radio- based terminal His research interests are in mode identification algorithms for software-defined radio platform in a single ... Van Dyck, and A Soltanian, “Interference of bluetooth and IEEE 802.11: simulation modeling and performance evaluation,” in Proc 4th International ACM...

Ngày tải lên: 23/06/2014, 01:20

13 456 0
Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt

Báo cáo sinh học: "Immediate transfection of patient-derived leukemia: a novel source for generating cell-based vaccines" ppt

... nucleofected samples The majority of the samples we analyzed were bone marrow aspirates In patients with advanced disease, autologous bone marrow may prove to be both an accessible and abundant source ... marrow involvement For example, the large amount of tumor material typically available from leukemia patients makes these cells accessible for autologous patient-derived vaccine...

Ngày tải lên: 14/08/2014, 19:22

13 257 0
w