MODELING OF THE ELECTROCHEMICAL CONVERSION OF CO2 IN MICROFLUIDIC REACTORS

MODELING OF THE ELECTROCHEMICAL CONVERSION OF CO2 IN MICROFLUIDIC REACTORS

MODELING OF THE ELECTROCHEMICAL CONVERSION OF CO2 IN MICROFLUIDIC REACTORS

... on developing a mathematical modeling framework for the electrochemical conversion of CO2 to CO in microfluidic reactors Conversion of CO2 into CO is attractive due to the versatility of CO (with ... reduction of CO2 in a microfluidic cell In order to develop a mathematical model for the electrochemical reduction of CO2 in a microfluidic cell,...

Ngày tải lên: 09/09/2015, 08:12

132 2,5K 0
Modeling of diffusion in mechanical alloying

Modeling of diffusion in mechanical alloying

... MODELING OF DIFFUSION IN MECHANICAL ALLOYING YANG CHENG, M ENG A THESIS SUBMITTED FOR THE DEGREE OF MASTER OF ENGINEERING DEPARTMENT OF MECHANICAL ENGINEERING NATIONAL UNIVERSITY OF SINGAPORE ... contribute little to the increase in homogenization kinetics in such diffusion process However, the density of defect during mechanical alloying increases with mech...

Ngày tải lên: 26/11/2015, 12:38

100 319 0
Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

Tài liệu Báo cáo Y học: BIGH3 (TGFBI) Arg124 mutations influence the amyloid conversion of related peptides in vitro Implications in the BIGH3-linked corneal dystrophies pptx

... suggesting the importance of the hydrophobic NH2-end of the peptides In the same way, removing the CONH2-terminus of the peptides resulted in increased amyloid fibril formation This increase may be ... structures of the peptides, thereby limiting amyloid fibril formation Fig Secondary structure determination of the peptides by FT-IR spectroscopy in D2O...

Ngày tải lên: 21/02/2014, 01:21

8 471 0
Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

Báo cáo khoa học: Modeling of ATP–ADP steady-state exchange rate mediated by the adenine nucleotide translocase in isolated mitochondria potx

... protons into the matrix, bypassing F0 F1-ATPsynthase [6] The dotted line shows the result of the modeling after estimation of the unknown parameters The con- Modeling of ANT ditions of the described ... novel kinetic assay of mitochondrial ATPADP exchange rate mediated by the ANT Biophys J 96, 24902504 Metelkin E, Goryanin I & Demin O (2006) Mathematical...

Ngày tải lên: 16/03/2014, 00:20

14 445 0
modeling of the conduction in a wo3 thin film as ozone sensor

modeling of the conduction in a wo3 thin film as ozone sensor

... spread out between adjacent grains is increased by oxidizing vapours and decreased in the opposite case [6–8], that implies a variation of resistivity in the same way Since 1980, many authors have ... polycrystalline layer made up of grains which have a great disparity of shape and size In this work, the grains are supposed to be quasi-spherical, identical in size, and...

Ngày tải lên: 20/03/2014, 13:04

8 666 0
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot

... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was con...

Ngày tải lên: 23/03/2014, 17:21

7 384 1
Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

Báo cáo hóa học: " Research Article Modeling On-Body DTN Packet Routing Delay in the Presence of Postural Disconnections" ppt

... computing packet transfer delay for a series of DTN routing algorithms that can be implemented in an on-body setting Although a number of papers in the literature [12–17] have studied DTN routing in ... implemented using a timer The delay of utility-based routing is expected to be lower than that in OPPT and RAND routing Also, the number of packet f...

Ngày tải lên: 21/06/2014, 11:20

19 351 0
Báo cáo khoa học: " Kinetic modeling of tumor growth and dissemination in the craniospinal axis: implications for craniospinal irradiation" pps

Báo cáo khoa học: " Kinetic modeling of tumor growth and dissemination in the craniospinal axis: implications for craniospinal irradiation" pps

... the ultimate goal of evaluating and optimizing therapeutic intervention within the contexts of these models [11] In this report we describe a kinetic model of tumor transport in the craniospinal ... of the spine temporarily while treatment of the brain continues Since the brain and spine are in communication via the cerebrospinal fluid, holding treatmen...

Ngày tải lên: 09/08/2014, 10:21

9 334 0
Báo cáo y học: "Predictive network modeling of the highresolution dynamic plant transcriptome in response to nitrate" pps

Báo cáo y học: "Predictive network modeling of the highresolution dynamic plant transcriptome in response to nitrate" pps

... from to 20 minutes, and modeled the resulting sequence using a dynamical model Instead of learning the dynamics directly from the gene expression sequence, we took into account uncertainty and ... regulatory network (GRN) (22 links) We used this network (next section) to analyze the NO3- response of sentinel genes to transcription factors We are confident in dynamica...

Ngày tải lên: 09/08/2014, 22:23

19 440 0
Báo cáo y học: " In silico modeling indicates the development of HIV-1 resistance to multiple shRNA gene therapy differs to standard antiretroviral therapy" docx

Báo cáo y học: " In silico modeling indicates the development of HIV-1 resistance to multiple shRNA gene therapy differs to standard antiretroviral therapy" docx

... the gene therapy ex vivo and returned to the patient to engraft and to continuously give rise to a supply of gene- containing CD4+ progeny T cells through the thymus [21] A proportion of all infected ... effects of HIV Methods This stochastic model of gene therapy for HIV incorporated the introduction of multiple anti-HIV shRNA into HSC cells which then...

Ngày tải lên: 13/08/2014, 01:20

14 256 0
Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx

Báo cáo y học: "Mathematical modeling of the socalled Allis test: a field study in orthopedic confusion" docx

... we are not aware of any investigations of the Allis protocol for determining aLLI In our search for information on the Allis test, nomenclatural and procedural issues became apparent, as explained ... reliable and valid ways of measuring LLI are needed There is no way to assess the clinical impact of LLI, both anatomical and functional, without having a convincing method...

Ngày tải lên: 13/08/2014, 14:20

7 710 0
Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc

Báo cáo y học: " Research In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of β-amyloid plaques associated with Alzheimer''''s disease" doc

... al., In silico modeling of the specific inhibitory potential of thiophene-2,3-dihydro-1,5-benzothiazepine against BChE in the formation of ?-amyloid plaques associated with Alzheimer's disease Theoretical ... whereas the activity of AChE declines BChE may, therefore, play a more prominent role in ACh hydrolysis in the aging brain The presenc...

Ngày tải lên: 13/08/2014, 16:20

26 279 0
Mathematical modeling of transport phenomena in electrochemical energy storage systems

Mathematical modeling of transport phenomena in electrochemical energy storage systems

... declare that the thesis is my original work and it has been written by me in its entirety I have duly acknowledged all the sources of information which have been used in the thesis This thesis has ... information which have been used in the thesis This thesis has also not been submitted for any degree in any university previously _ Karthik Somasundaram 17 October 2012 à

Ngày tải lên: 09/09/2015, 17:54

172 347 0
w