Adeno associated virus mediated thalassemia gene therapy InTech Book

Adeno associated virus mediated thalassemia gene therapy InTech Book

Adeno associated virus mediated thalassemia gene therapy InTech Book

... Generation of recombinant adeno- associated virus vectors by a complete adenovirus -mediated approach Mol Ther 2001; 3: 787-792 [40] Matsushita T, Elliger S, Elliger C et al: Adeno- associated virus ... more experiments in vivo19 AAV mediated β -thalassemia gene therapy Adeno- associated virus (AAV) is often found in cells that are simultaneously infected with adenoviru...

Ngày tải lên: 05/09/2015, 11:13

10 214 0
Báo cáo sinh học: "Attenuation of dengue virus infection by adeno-associated virus-mediated siRNA delivery" pdf

Báo cáo sinh học: "Attenuation of dengue virus infection by adeno-associated virus-mediated siRNA delivery" pdf

... developed an adeno-associated virus (AAV) system capable of expressing siRNA cassettes, and tested this vector with a siRNA cassette composed of a nucleotide sequence from the 3' NCR of the DEN ... for siRNA delivery and that this AAV system may be applied in clinical settings to attenuate DEN infection List of abbreviations AAV, adeno-associated virus; DCs, dendritic c...

Ngày tải lên: 14/08/2014, 19:22

10 279 0
Báo cáo sinh học: " The state of the art of adeno-associated virus-based vectors in gene therapy" ppt

Báo cáo sinh học: " The state of the art of adeno-associated virus-based vectors in gene therapy" ppt

... establishment of the first infectious clone of AAV serotype (AAV2) in 1982 [7] and the pioneering work on the successful cloning of AAV establishing the foundation of recombinant AAV vectors capable of ... the state of the art of AAV-based vector studies and the advances in the use of AAV vectors in several gene therapy approaches Characteristic...

Ngày tải lên: 18/06/2014, 18:20

7 484 0
Characterization of Fabry mice treated with recombinant adeno-associated virus 2/8-mediated gene transfer pdf

Characterization of Fabry mice treated with recombinant adeno-associated virus 2/8-mediated gene transfer pdf

... (Fig 5A-D) The podocytes of wild-type mice, Fabry mice, mice treated with ERT, and mice treated with rAAV-hAGA gene transfer are shown in Fig In the podocytes of the Fabry mice, foot process fusion ... Wild-type mice, (B) untreated Fabry mice, (C) Fabry mice treated with ERT, (D) Fabry mice treated with gene therapy (2 × 1012 particles of rAA...

Ngày tải lên: 10/08/2014, 05:21

10 181 0
Báo cáo sinh học: " Recombinant adeno-associated virus type 2-mediated gene delivery into the Rpe65-/- knockout mouse eye results in limited rescue" ppsx

Báo cáo sinh học: " Recombinant adeno-associated virus type 2-mediated gene delivery into the Rpe65-/- knockout mouse eye results in limited rescue" ppsx

... the high turnover, and rapid breeding and maturation time of mice to assess the efficacy of using rAAVmediated gene therapy to replace the missing RPE65 gene in the Rpe65-/- knockout strain The ... reduction in numbers of lipid droplets, the layer of basal infoldings was also thinner in rAAV.RPE65-injected eyes (Fig 6A and 6B) Immunostaining using the anti-SWC opsi...

Ngày tải lên: 14/08/2014, 19:22

15 400 0
Báo cáo sinh học: "The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression" docx

Báo cáo sinh học: "The recombinant adeno-associated virus vector (rAAV2)-mediated apolipoprotein B mRNA-specific hammerhead ribozyme: a self-complementary AAV2 vector improves the gene expression" docx

... Biosystems) The nucleotide sequences were as follows: Mouse apoB mRNA Forward primer 5' ATGTACTAATTGCCATAGATAGTGCCA, Reverse primer 5' TCGCGTATGTCTCAAGTTGAGAG, Probe: FAM-ATCAACTTCAATGAAAAA-MGBNFQ Mouse ... kit (Ambion) to remove the contaminating DNA RT-PCR was then performed in the presence of the forward primer RBF2 (5' AGATCCACAAGCTCCTGA) and reverse primer RBR1 (5' ATAAGCTGCAATAA...

Ngày tải lên: 14/08/2014, 19:22

11 223 0
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... calcium phosphate-mediated cotransfection of pAAV–CMV–GALNS, pAAV– AAT–GALNS or pAAV–CMV–SUMF1 with pXX2 and pXX6-80 (Gene Therapy Center, University of North Carolina at Chapell Hill, NC, USA) ... were transduced with · 10 10 vg of CMV– GALNS, AAT–GALNS or EF1–GALNS, and harvested 2, 4, and 10 days post-transduction All assays were carried out in duplicate Total DNA and RN...

Ngày tải lên: 29/03/2014, 21:20

12 465 0
Báo cáo sinh học: " Adeno-associated virus: from defective virus to effective vector" potx

Báo cáo sinh học: " Adeno-associated virus: from defective virus to effective vector" potx

... of helper viruses or genotoxic agents [50] Taken together, these phenomena indicate that AAV is not defective in absolute terms Adeno-associated virus vectorology General principle Historically, ... aided by the co-receptors v5 integrin heterodimers [21], fibroblast growth factor receptor type [22] and the hepatocyte growth factor receptor, c-Met [23] The use of ubiquitous heparan sulph...

Ngày tải lên: 19/06/2014, 08:20

17 678 0
Báo cáo y học: "Substitution of adeno-associated virus Rep protein binding and nicking sites with human Chromosome 19 sequences" pps

Báo cáo y học: "Substitution of adeno-associated virus Rep protein binding and nicking sites with human Chromosome 19 sequences" pps

... Substitution of adenoassociated virus Rep protein binding and nicking sites with human Chromosome 19 sequences Virology Journal 2010 7:218 Submit your next manuscript to BioMed Central and take full ... type Rep proteins on human chromosome 19 J Virol 2005, 79:3544-3556 32 Snyder RO, Im DS, Muzyczka N: Evidence for covalent attachment of the adeno-associat...

Ngày tải lên: 12/08/2014, 01:21

11 363 0
Báo cáo khoa học:" Transduction of rat pancreatic islets with pseudotyped adeno-associated virus vectors" doc

Báo cáo khoa học:" Transduction of rat pancreatic islets with pseudotyped adeno-associated virus vectors" doc

... numbers of rat islets, versus murine islets, also makes the use of rat islets desirable Therefore, we examined the transduction of rat islets by pseudotyped AAV vectors Results Transduction of Rat Islets ... Transduction of rat islets with AAVTGFP2/5 Transduction of rat islets with AAVTGFP2/5 (A) In vitro expression of TGF-beta in conditione...

Ngày tải lên: 12/08/2014, 04:21

10 199 0
Báo cáo y học: " Size does matter: overcoming the adeno-associated virus packaging limit" ppsx

Báo cáo y học: " Size does matter: overcoming the adeno-associated virus packaging limit" ppsx

... trials in the coming years With the newly expanded effective packaging capacity, the potential future applications of rAAV are indeed very broad References Muzyczka N: Adeno-associated virus (AAV) ... transgene expression, whereas with the split intron strategy only one of the four would work The only disadvantage of the enhancer strategy is that the coding sequence of...

Ngày tải lên: 12/08/2014, 18:20

3 169 0
Báo cáo sinh học: " Rapid, widespread transduction of the murine myocardium using self-complementary Adeno-associated virus" pptx

Báo cáo sinh học: " Rapid, widespread transduction of the murine myocardium using self-complementary Adeno-associated virus" pptx

... the apex The amount of GFP expression increased over the time course of the experiment in both of the scAAV and ssAAV transduced animals Nonetheless, the amount of GFP expression seen in the scAAV ... and then cut into thirds representing the apical region, the middle region and the base region of the heart The tissue was then fixed for 12 hours with 4% paraf...

Ngày tải lên: 14/08/2014, 19:22

6 184 0
Báo cáo sinh học: " In vitro evaluation of a double-stranded selfcomplementary adeno-associated virus type2 vector in bone marrow stromal cells for bone healing" pptx

Báo cáo sinh học: " In vitro evaluation of a double-stranded selfcomplementary adeno-associated virus type2 vector in bone marrow stromal cells for bone healing" pptx

... this article as: Alaee et al.: In vitro evaluation of a double-stranded self-complementary adeno-associated virus type2 vector in bone marrow stromal cells for bone healing Genetic Vaccines and ... with various AAV vectors [50-52] have indicated success in allograft integration and bone healing in mice via increased vascularization and remodelling (rAAV...

Ngày tải lên: 14/08/2014, 19:22

8 258 0
w