METHOD FOR THE INVERSION OF RESISTIVITY SOUNDING AND PSEUDOSECTION DATA

METHOD FOR THE INVERSION OF RESISTIVITY SOUNDING AND PSEUDOSECTION DATA

METHOD FOR THE INVERSION OF RESISTIVITY SOUNDING AND PSEUDOSECTION DATA

... point The depth of the center of the block is set at the equivalent depth of the array (0.5 times the electrode spacing for the Wenner array) Note that the left and the right edges for the blocks ... is the weight of central datum point, and C, represents the weight of surrounding points The sum of all the weights is normalized to 1.0 Near the...

Ngày tải lên: 06/08/2015, 00:01

12 315 0
INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

INTERNATIONAL STANDARD Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp docx

... v INTERNATIONAL STANDARD ISO 6579:2002(E) Microbiology of food and animal feeding stuffs — Horizontal method for the detection of Salmonella spp WARNING — In order to safeguard the health of ... Members of ISO and IEC maintain registers of currently valid International Standards ISO 6887-1, Microbiology of food and animal feedin...

Ngày tải lên: 07/03/2014, 16:20

34 691 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... Capture probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 ... on the basis of the cutoff value Detection of HPV- 16 with QDs and superparamagnetic nanoparticle-based hybridization The rationale of QDs and superparamagnetic nanopartic...

Ngày tải lên: 21/06/2014, 01:20

9 472 0
A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

A FUNCTIONAL-ANALYTIC METHOD FOR THE STUDY OF DIFFERENCE EQUATIONS EUGENIA N. PETROPOULOU AND potx

... to study partial difference equations of three and four variables The aim of this paper is to present the generalization of this functional-analytic method for the study of linear and nonlinear ... to apply Theorem 1.1 to the preceding operator equation and obtain information for the initial linear difference equation under consideration In the case of...

Ngày tải lên: 23/06/2014, 00:20

12 258 0
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc

... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings togeth...

Ngày tải lên: 14/02/2014, 13:20

22 711 0
Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions   pdf

Tài liệu APICE: Common Mediterranean strategy and local practical Actions for the mitigation of Port, Industries and Cities Emissions   pdf

... port cities Experimental analysis and modellistic evaluation carried on within APICE project were preceded by a comparative evaluation of the air quality  pollution in the port cities   involved ... devoted to the discussion of the results of the intercomparison campaign held in Marseille in February 2011 In addition, the recent developments of the common approa...

Ngày tải lên: 17/02/2014, 22:20

4 455 0
Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

Tài liệu Carrots, Sticks, and Promises: A Conceptual Framework for the Management of Public Health and Social Issue Behaviors docx

... behave to accommodate the manager and the target (See, for example, the case of iodized salt discussed in P2 in the section "A Conceptual Framework for Public Health and Social Issue Behavior Management. ") ... selection of education, marketing, and law as sets of tools that can be brought to bear on the management of public health and social...

Ngày tải lên: 18/02/2014, 02:20

14 789 0
Ergonomic Principles and Checklists for the Selection of Office Furniture and Equipment doc

Ergonomic Principles and Checklists for the Selection of Office Furniture and Equipment doc

... developing a series of checklists for the ergonomic evaluation of office furniture and equipment Checklists for the ergonomic evaluation of products are useful for the following reasons: # They require ... iii ERGONOMIC PRINCIPLES FOR THE SELECTION OF OFFICE FURNITURE AND EQUIPMENT Introduction The Ergonomics Unit at Worksafe Australia r...

Ngày tải lên: 08/03/2014, 13:20

45 1,2K 1
a novel method for the synthesis of titania nanotubes using

a novel method for the synthesis of titania nanotubes using

... al for amorphous titania nanotubes [30] However, the annealed titania nanotubes are crystalline (mostly anatase) and show varied activity depending on the material preparation and annealing atmosphere ... (3.3 mA/cm2 ; Fig 13) This is due to the lower band gap of carbon-doped titania nanotubes compared with N2 - and O2 annealed nanotubes The lower the band gap of...

Ngày tải lên: 05/05/2014, 15:26

8 638 0
a novel method for the synthesis of cao nanoparticle

a novel method for the synthesis of cao nanoparticle

... capping CuO, AP-Fe2O3, AP-Al2O3 and AP -CaO [15­ agent was reported Then, we have focused 20] There are several methods for the synthesis our attention on the CaO nanoparticles/ of nanoscale CaO, including ... (2013) GC analysis illustrated that 75% and 100% of 2-CEPS For the evaluation of the reaction of 2-CEPS in contact to the CaO NPs with weight ratio as a...

Ngày tải lên: 06/05/2014, 08:55

12 707 0
solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

solgel based hydrothermal method for the synthesis of 3d flowerlike zno microstructures

... patterns of the ZnO sample synthesized at 120 ◦C for 17 h hydrothermal treatment Figure a b d e c f Fig SEM images of the time-dependent evolution in the formation of 3D flower-like ZnO synthesized ... of the formation process of the 3D flower-like ZnO Figure Fig (a) Bar graph illustration of the photocatalytic degradation of KGL using ZnO samples s...

Ngày tải lên: 06/05/2014, 13:26

26 553 0
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx

... of the sterility testing in compliance with eu Pharmacopoeia 2.6.1 (sterility) and the validation of the potency assay in an ATMP that is constituted of bone- marrow mononucleated cells used in ... using cell systems and in vivo assays using animal models As concerning the use of bone marrow mononucleated cells in cardiac repair, the...

Ngày tải lên: 18/06/2014, 15:20

9 778 0
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot

... with the planning and preparation of the manuscript PIF and AES participated in the cutting and staining of Page of the bone tissue RGR participated in the planning of the experiments, data analysis ... analysis and the preparation of the manuscript MJS supervised the study planning, data analysis and preparation of the manuscript All authors read and approve...

Ngày tải lên: 20/06/2014, 04:20

4 403 0
báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

báo cáo hóa học:" Mid-term results of ponseti method for the treatment of congenital idiopathic clubfoot (A study of 67 clubfeet with mean five year follow-up)" pot

... literature The purpose of this study was to evaluate the midterm effectiveness of the Ponseti method [4] for the treatment of congenital idiopathic clubfoot Materials and methods A total of 49 patients ... A method for the early evaluation of the Ponseti (Iowa) technique for the treatment of idiopathic clubfoot J Pediatr Orthop 2003, 12(...

Ngày tải lên: 20/06/2014, 04:20

7 535 0
w