The Omission of that

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

Metaphor, based on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers

... on the association of similarity, is one of the two basic types of semantic transference that have been an interest for many linguistic researchers. Galperin ( 1981: 139-40) states that the ... part the language is playing, what it is that the participants are expecting the language to do for them in that situation, the sy...

Ngày tải lên: 07/11/2012, 14:44

53 1K 3
Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement

Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement

... Accepted October 21, 2010. - 421 - Evaluation of the Characteristics of Microorganisms that Contribute to Denitrification in the Paddy Drainage Treatment Apparatus by Quinone Composition Measurement ... denitrification in paddies. The arrangement of environmental factors of paddy, focusing on the Q-8 and other highly-contained-quinones,...

Ngày tải lên: 05/09/2013, 10:15

7 572 0
Tài liệu Develop computer programs for simplifying sums that involve binomial coefficients: The Art of Computer Programming, Volume 1: Fundamental Algorithms pdf

Tài liệu Develop computer programs for simplifying sums that involve binomial coefficients: The Art of Computer Programming, Volume 1: Fundamental Algorithms pdf

... you that a better first step is to reach for your computer! [50] Develop computer programs for simplifying sums that involve binomial coefficients. Exercise 1.2.6.63 in The Art of Computer Programming, ... 1)(k − n − 1) . 3. For each of the four parts of Problem 2 above, write out the complete proof of the identity, using the full text of the...

Ngày tải lên: 20/12/2013, 19:15

222 552 0
Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

Tài liệu Báo cáo khoa học: Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme doc

... Journal compilation ê 2010 FEBS 1287 Crystal structure of Klebsiella sp. ASR1 phytase suggests substrate binding to a preformed active site that meets the requirements of a plant rhizosphere enzyme Kerstin ... with substrate- free AppA the C a atoms are 2.41 A ˚ apart, whereas for the substrate- free PhyK and the substrate- loaded...

Ngày tải lên: 16/02/2014, 09:20

13 766 0
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf

... 1903 Evidence that the assembly of the yeast cytochrome bc 1 complex involves the formation of a large core structure in the inner mitochondrial membrane Vincenzo Zara 1 , Laura Conte 1 and Bernard ... respiratory chain, the assistance of specific chaperone proteins is also required. The available data indicate that the accessory factor Bc...

Ngày tải lên: 18/02/2014, 08:20

15 641 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc

... a wider variety of substrates than do CBP21 and CHB1. Degradation of a- and b-chitin The degradation rates of a- and b-chitin were assayed with LlChi1 8A in the presence or absence of LlCBP3 3A. ... 5Â-GGTATTGAGGGTCGCCATGGTTATGTTC AATCACCA-3Â; reverse primer, 5Â-AGAGGAGAGTTAG AGCCTTACAAGAAGGGTCCAAAGA-3Â). The PCR product was puried, treated with T4 exonuclea...

Ngày tải lên: 18/02/2014, 08:20

14 684 0
Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx

Economic Effects of Reducing the Fiscal Restraint That Is Scheduled to Occur in 2013 docx

... 254(i), no longer apply. ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 7 CBO Table 3. Effect on Employment of Reducing Fiscal Restraint in 2013 Under Various ... by CBO. ECONOMIC EFFECTS OF REDUCING THE FISCAL RESTRAINT THAT IS SCHEDULED TO OCCUR IN 2013 5 CBO 2013 and, therefore, p...

Ngày tải lên: 15/03/2014, 20:20

10 538 0
Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc

Authoring and Generating Health-Education Documents That Are Tailored to the Needs of the Individual Patient doc

... problems that arise when a tailored instance of the document is to be generated. 1 The Value of Tailored Health-Education Documents Health-education and patient- information brochures and leaflets are ... a list of the patient conditions that the author is using to specify the selection of pieces of text. The right-hand portion of the screen...

Ngày tải lên: 22/03/2014, 15:21

12 379 0
Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

Báo cáo khoa học: Characterization of the interactions of the nephrin intracellular domain Evidence that the scaffolding protein IQGAP1 associates with nephrin potx

... obtain enough protein for MALDITOF-MS. Intracellular domain of nephrin X. L. Liu et al. 234 FEBS Journal 272 (2005) 228243 ê 2004 FEBS Characterization of the interactions of the nephrin intracellular domain Evidence ... map the areas of the neph- rin intracellular domain responsible for IQGAP1 binding. All constructs containing the C-terminal half...

Ngày tải lên: 23/03/2014, 13:20

16 334 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... antibodies L. Rian˜ o-Umbarila et al. 2592 FEBS Journal 272 (2005) 25912601 ê 2005 FEBS A strategy for the generation of specific human antibodies by directed evolution and phage display An example ... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC JH3.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCC...

Ngày tải lên: 23/03/2014, 13:20

11 681 0
w